Abstract:The Wnt/β-catenin pathway is constitutively active and promotes multiple tumor processes, including breast cancer metastasis. However, the underlying mechanism by which the Wnt/β-catenin pathway is constitutively activated in breast cancer metastasis remains unclear. Inhibition of Wnt antagonists is important for Wnt/β-catenin signaling activation, and post-transcriptional regulation of these antagonists by microRNAs (miRNAs) might be a possible mechanism underlying signaling activation. Regulation of nuclear pre-mRNA domain-containing 1A (RPRD1A) is a known inhibitor of cell growth and Wnt/β-catenin signaling activity, but the function and regulatory mechanism of RPRD1A in breast cancer have not been clarified. The aim of this study was to understand how regulators of the Wnt/β-catenin pathway may play a role in the metastasis of this cancer. Methods: RPRD1A expression and its association with multiple clinicopathological characteristics was analyzed immunohistochemically in human breast cancer specimens. miR-454-3p expression was analyzed using real-time PCR. RPRD1A or miR-454-3p knockdown and overexpression were used to determine the underlying mechanism of their functions in breast cancer cells. Xenografted tumor model, 3D invasive culture, cell migration and invasion assays and sphere formation assay were used to determine the biofunction of RPRD1A and miR-454-3p in breast cancer. Electrophoretic mobility shift assay (EMSA), luciferase reporter assay, and RNA immunoprecipitation (RIP) were performed to study the regulation and underlying mechanisms of RPRD1A and miR-454-3p expression and their correlation with the Wnt/β-catenin pathway in breast cancer. Results: The Wnt/β-catenin signaling antagonist RPRD1A was downregulated and its upstream regulator miR-454-3p was amplified and overexpressed in metastatic breast cancer, and both were correlated with overall and relapse-free survival in breast cancer patients. The suppression by miR-454-3p on RPRD1A was found to activate Wnt/β-catenin signaling, thereby promoting metastasis. Simultaneously, three other negative regulators of the Wnt/β-catenin pathway, namely, AXIN2, dickkopf WNT signaling pathway inhibitor (DKK) 3 and secreted frizzled related protein (SFRP) 1, were also found to be targets of miR-454-3p and were involved in the signaling activation. miR-454-3p was found to be involved in early metastatic processes and to promote the stemness of breast cancer cells and early relapse under both in vitro and in vivo conditions. Conclusions: The findings indicate that miR-454-3p-mediated suppression of Wnt/β-catenin antagonist RPRD1A, as well as AXIN2, DKK3 and SFRP1, sustains the constitutive activation of Wnt/β-catenin signaling; thus, miR-454-3p and RPRD1A might be potential diagnostic and therapeutic targets for breast cancer metastasis.

MicroRNA-7 Suppresses the Homing and Migration Potential of Human Endothelial Cells to Highly Metastatic Human Breast Cancer Cells

TTCCAAGACTTTTTCTGCCT ACTGAACCTGACCGTACATGCGCAAGCTATAAACAAAG EGFR AGAGTCTCAAAGCCATGTT ACTGAACCTGACCGTACACCATCCTAAGCATGACTCC ERK ACACGCAGTTGCAGTACA ACTGAACCTGACCGTACAGGGGCTGATCTTCTTGAT GAPDH CTGAGTACGTCGTGGAGTC ACTGAACCTGACCGTACACAGAGATGATGACCCTTTTG GRO a TCTTCCGCTCCTCTCAC ACTGAACCTGACCGTACA CGGACGCTC

Downregulation of exosomal miR-7-5p promotes breast cancer migration and invasion by targeting RYK and participating in the atypical WNT signalling pathway

MicroRNA-7 Inhibits Epithelial-to-mesenchymal Transition and Metastasis of Breast Cancer Cells Via Targeting FAK Expression.

MicroRNA-7 agomir is a potential bioactive materia for breast cancer herapy by inhibiting breast cancer stem cell tumorigenicity

Microrna-497 Targets Smad7 And Has A Tumour Suppressive Effect And Its Prognostic Significance In Breast Cancer

MicroRNA-34a Inhibition of the TLR Signaling Pathway Via CXCL10 Suppresses Breast Cancer Cell Invasion and Migration.

MiR-454-3p-Mediated Wnt/β-catenin Signaling Antagonists Suppression Promotes Breast Cancer Metastasis

MicroRNA-4500 Inhibits Migration, Invasion, and Angiogenesis of Breast Cancer Cells Via RRM2-Dependent MAPK Signaling Pathway

The Molecular Mechanisms and Therapeutic Potential of Microrna-7 in Cancer

MicroRNA-7 inhibits tumor growth and metastasis by targeting the phosphoinositide 3-kinase/Akt pathway in hepatocellular carcinoma.

Microrna-7 Suppresses the Invasive Potential of Breast Cancer Cells and Sensitizes Cells to DNA Damages by Targeting Histone Methyltransferase SET8*

MicroRNA-7 inhibits tumor metastasis and reverses epithelial-mesenchymal transition through AKT/ERK1/2 inactivation by targeting EGFR in epithelial ovarian cancer.

MicroRNA-205-5p inhibits the growth and migration of breast cancer through targeting Wnt/β-catenin co-receptor LRP6 and interacting with lncRNAs

Mirna-107 Inhibits Proliferation And Migration By Targeting Cdk8 In Breast Cancer

Promotional Effect of Microrna-194 on Breast Cancer Cells Via Targeting F-box/WD Repeat-Containing Protein 7.

MicroRNA-7: a promising new target in cancer therapy

MicroRNA-7 Inhibits Tumor Metastasis and Reverses Epithelial-Mesenchymal Transition Through AKT/ERK1/2 Inactivation by Targeting EGFR in Epithelial Ovarian Cancer

Micro-RNA193a-3p Inhibits Breast Cancer Cell Driven Growth of Vascular Endothelial Cells by Altering Secretome and Inhibiting Mitogenesis: Transcriptomic and Functional Evidence

MiRNA-497 regulates cell growth and invasion by targeting cyclin E1 in breast cancer

MicroRNA-7 Arrests Cell Cycle in G1 Phase by Directly Targeting CCNE1 in Human Hepatocellular Carcinoma Cells