Abstract:Seedling rot symptoms were observed at Research Farm of ICAR-Indian Institute of Soybean Research, Indore, India. The infected seedlings had water-soaked lesions on the cotyledons and hypocotyls that gradually developed into brown lesions and further progressed to soft rot. These seedlings could be easily pulled-off from the soil. The diseased seedling samples were rinsed thoroughly in flowing tap water and eventually in double-distilled water and were subjected to surface sterilization with NaOCl(1%). The samples were further washed thrice with sterilized double distilled water. The root fragments were properly sterilized and placed on V8 juice agar as well as potato dextrose agar (PDA) media plates. These plates were incubated at 27± 2°C for 48 hours. After incubation, white fluffy mycelial growth was observed on both the media. The fungus was observed to produce brown round vesicles with mycelial attachment when observed under a compound microscope magnification of 20X. Subcultures of these fungal isolates were placed on PDA media and incubated for 7 days at (27±2°C). The pure fungal culture along with PDA media was cut into small pieces and mixed with a sterilized soil mix (70% soil and 20% sand and 10 % vermicompost) at the rate of one petri dish per pot (plastic pots of 10 cm depth) and covered properly with tin foil. These pots were subjected to substrate colonization for 10 days at room temperature and the substrates were shaken occasionally to improve infection efficiency of pathogen by enhacing inocula production. Seeds of soybean variety, Gaurav were sown in three replicates, each with 10 seeds in the inoculated pots. The control was established by sowing seeds in the soil mix, amended previously with plain PDA. The pots were maintained at 25 to 30 ºC with 45 to 50 % of soil moisture content under glasshouse conditions. In the inoculated pots, the fungus killed soybean seeds before and after germination. Some of the plants that emerged developed lesions were initially yellow and gradually turned to necrotic later. These lesions were found on the roots of the plant and at the base of the hypocotyl region. The soybean seeds planted in un-inoculated soil emerged but did not develop any necrotic lesions. When the causal organism was re-isolated from the diseased plant part it was found to be morphologically and culturally similar to theoriginal culture. The isolated pathogen was thus classified as Pythium deliense based on morphological and cultural characters as well as the pathogenicity test. (Plaats-Niterink 1981). For further confirmation of pathogen's identity, complete genomic DNA of the fungus was extracted using the HiPurA Fungal DNA Purification Kit (HiMedia, India). The nuclear rDNA region of the internal transcribed spacer and 5.8S rDNA was amplified by universal primers ITS 1 (5' TCCGTAGGTGAACCTGCGG 3') and ITS 4 (5' TCCTCCGCTTATTGATATGC 3') as mentioned by White et al. (1990). Amplification was performed in a 12.5 μL reaction volume containing 1.5 μL of 10X PCR buffer, 3 μL of 25 mM MgCl2, 1.2 μL of 2.5 mM deoxyribonucleotide triphosphates (dNTPs), 0.7 μL of 10 pM each primer (ITS 1 and ITS 4), and 1 μL of DNA template, 0.3 μL of 1 units of Taq DNA polymerase. The thermal cycle consisted of 4-minute initial denaturation at 94°C, followed by 35 cycles of 1-minute denaturation at 95°C, 30-second primer annealing at 57 The PCR products were sequenced and submitted to NCBI (GenBank Acc. MT2665888). The BLAST study of the fungal isolate showed 100% similarity with reference sequences of Pythium deliense (MT126658.1) in the GenBank. The isolate was identified as Pythium deliense on the basis of molecular analysis, corroborating the above morphological identification. Further, the beta-tubulin gene (Bt) was amplified with primers BtF (5'GCTGGCCTTGATGTTGTTCG3') and BtR (5'CGTGA AGAGTACCCAGAC CG3'). Similarly, the cytochrome oxidase gene was amplified with primers COXF (5'GGTGCTTTTTCAGGTGTAGTTGG3') and COXR (5'GCTCCTGCTAATACTGGTAATG T3'). The PCR products were sequenced and submitted to GenBank with accession numbers MW196444 and MW196445 respectively. In BLAST analysis, the beta-tubulin gene exhibited 100 percent sequence homology with Pythium deliense (MK752986.1) and cytochrome oxidase gene also showed 100 % sequence homology with Pythium deliense (HQ708566.1). Pythium deliense has been recorded worldwide causing disease in many agricultural crops including soybean but to our knowledge, this is the first study in India of the genus Pythium and Pythium deliense causing root rot and damping off of soybean.

Isolation Ofpythium Litoralefrom Irrigation Ponds Used for Vegetable Production and Its Pathogenicity on Squash

Pythium and Globisporangium species associated with cucumber rhizosphere causing damping-off and their effects on cucumber seed decay in Oman

Spatial variation of oomycetes and bacteria on surfaces, solutions, and plants from a commercial hydroponic greenhouse

Plant pathogenic bacteria in open irrigation systems: what risk for crop health?

An assessment of the species diversity and disease potential of Pythium communities in Europe

Microbial Origin of Aquaponic Water Suppressiveness against Pythium aphanidermatum Lettuce Root Rot Disease

Root rot of spinach caused by Pythium myriotylum and P. aphanidermatum in Taiwan

First report of root rot and damping off disease in soybean (Glycine max) caused by Pythium deliense in India

Isolation and Molecular Characterization of Plant-Growth-Promoting Bacteria and Their Effect on Eggplant (solanum Melongena) Growth

Monitoring by real-time PCR of three water-borne zoosporic Pythium species in potted flower and tomato greenhouses under hydroponic culture systems

First report of Pythium myriotylum causing root rot on soybean in the Republic of Korea

Biocontrol potential of endophytic Pseudomonas strain IALR1619 against two Pythium species in cucumber and hydroponic lettuce

Isolation, Identification and Characterization of Rhizobacteria Strains for Biological Control of Bacterial Wilt (ralstonia Solanacearum) of Eggplant in China

Biological activity of Pythium oligandrum against Phytophthora species

First Report of Phomopsis longicolla Causing Stem Canker of Eggplant in Guangdong, China

Zoospore encystment-based and cabin sequestering methods for isolation and salvaging Phytophthora from infested rhizospheric soils

Genome of <i>Pythium myriotylum</i> Uncovers an Extensive Arsenal of Virulence-Related Genes among the Broad-Host-Range Necrotrophic <i>Pythium</i> Plant Pathogens

Non-Pathogenic Pythium Induced the Resistance in Hydroponic Lettuce Against Root Rot Disease

A Survey of Phytophthora spp. in Eastern Indian Nurseries and Their Sensitivity to Six Oomycete-Targeted Commercial Fungicides

First Report of Pythium Cluster B2a Species Causing Root Rot in Welsh Onion

A Diagnostic Guide for Phytophthora capsici Infecting Vegetable Crops