Abstract:The inositol-requiring enzyme-1 (IRE1)-X-box binding protein 1 (IRE1-XBP1) pathway is the key branch of the unfolded protein response (UPR). To investigate the role of the IRE1-XBP1 pathway in reducing environmental stress and increasing anti-viral immunity in Litopenaeus vannamei, homologues of IRE1 (designated as LvIRE1) and XBP1 (designated as LvXBP1) were identified and characterized. The full-length cDNA of LvIRE1 is 4908bp long, with an open reading frame (ORF) that encodies a putative 1174 amino acid protein. The full-length cDNA of LvXBP1 is 1746bp long. It contains two ORFs that encode putative 278 amino acid and 157 amino acid proteins, respectively. LvXBP1 mRNA has the predicted IRE1 splicing motifs CNG'CNGN located within the loop regions of two short hairpins. Sequencing of the splicing fragment induced by endoplasmic reticulum (ER)-stress showed a 3bp or 4bp frame shift from the predicted sites. The spliced form LvXBP1 (LvXBP1s) contained an ORF encodes a putative 463 amino acid protein. The reporter gene assays indicated that LvXBP1s activates the promoter of L. vannamei immunoglobulin heavy chain binding protein (LvBip), an important UPR effector. RT-PCR showed that LvXBP1 was spliced during the experiments. For heat shock treatment, the total LvXBP1 expression was increased and peaked at about 36h, whereas the percentages of the two isoforms were relatively stable. For the WSSV challenge, LvXBP1 was upregulated during the experiment and the percentage of the spliced form continuously declined after 18h of infection. Knock-down of LvXBP1 by RNA interference resulted in a lower cumulative mortality of L. vannamei under WSSV infection. Furthermore, the expression profiles of LvIRE1 and LvXBP1 in the gills, hemocytes, intestines, and hepatopancreas of the WSSV-challenged shrimp were detected using real-time RT-PCR. Taken together, these results confirm that the IRE1-XBP1 pathway is important for L. vannamei environmental stress resistance, suggest that L. vannamei IRE1-XBP1 may activated by WSSV and be annexed to serve the virus.

Identification and functional characterization of a solute carrier family 15, member 4 gene in Litopenaeus vannamei

Identification and Functional Characterization of a Novel Spätzle Gene in Litopenaeus Vannamei

Tgaagatggtcgaggggtaagccg ggcatcagacccatcacccagaa tacc ttgaagccgaaacacagagcca atct tactgtgttcattgtgtcattgg acgagtccgagttcat aggttgacgaggaaca ttgcgccgtactcat ggtctgtccgttctt acggaattccctcct tgcaacgcatagacc actctccttacgatg cagacaggtctccaa ccacctgactgtacc tactgacgaggcaat ctggaggaggaaact agacacttggactcg

Identification and Functional Characterization of a Glucose Regulated Protein 94 Gene in Litopenaeus Vannamei and Its Responsiveness in WSSV Infection.

Identification, Characterization, and Function Analysis of the NF-κB Repressing Factor (NKRF) Gene from Litopenaeus Vannamei

The immune function of a NLR like gene, LvNLRPL1, in the Pacific whiteleg shrimp Litopenaeus vannamei

Cloning and characterization of a novel C-type lectin gene from shrimp Litopenaeus vannamei.

Molecular Cloning, Characterization And Expression Analysis Of The Tumor Necrosis Factor (Tnf) Superfamily Gene, Tnf Receptor Superfamily Gene And Lipopolysaccharide-Induced Tnf-Alpha Factor (Litaf) Gene From Litopenaeus Vannamei

Identification and functional characterization of a C-type lectin gene from Litopenaeus vannamei that is associated with ER-stress response.

A C-type Lectin (lvctl4) from Litopenaeus Vannamei is a Downstream Molecule of the NF-κB Signaling Pathway and Participates in Antibacterial Immune Response

Functional Characterization of A Deformed Epidermal Autoregulatory Factor 1 Gene in Litopenaeus vannamei

Activating Transcription Factor 4 and X Box Binding Protein 1 of Litopenaeus Vannamei Transcriptional Regulated White Spot Syndrome Virus Genes Wsv023 and Wsv083

Molecular Characterization and Expression Analysis of the C-Type Lectin Domain Family 4 Member F in Litopenaeus vannamei against White Spot Syndrome Virus

Identification, Characterization, And Function Analysis Of The Cactus Gene From Litopenaeus Vannamei

Identification and characterization of Inositol-requiring enzyme-1 and X-box binding protein 1, two proteins involved in the unfolded protein response of Litopenaeus vannamei

Identification and Functional Characterization of an Endoplasmic Reticulum Oxidoreductin 1-Α Gene in Litopenaeus Vannamei.

Comparative Study of Five Anti-Lipopolysaccharide Factor Genes in Litopenaeus Vannamei.

Identification of a C-type Lectin with Antiviral and Antibacterial Activity from Pacific White Shrimp Litopenaeus Vannamei.

Molecular cloning, characterization and expression analysis of Wnt4, Wnt5, Wnt6, Wnt7, Wnt10 and Wnt16 from Litopenaeus vannamei.

Identification and Functional Characterization of Heat Shock Transcription Factor1 in Litopenaeus Vannamei

Identification of an Ortholog of MALT1 from Shrimp That Induces NF-κB-Mediated Antiviral Immunity.