Abstract:Waardenburg syndrome (WS) is a prevalent hearing loss syndrome, concomitant with focal skin pigmentation abnormalities, blue iris, and other abnormalities of neural crest-derived cells, including Hirschsprung's disease. WS is clinically and genetically heterogeneous and it is classified into four major types WS type I, II, III, and IV (WS1, WS2, WS3, and WS4). WS1 and WS3 have the presence of dystopia canthorum, while WS3 also has upper limb anomalies. WS2 and WS4 do not have the dystopia canthorum, but the presence of Hirschsprung's disease indicates WS4. There is a more severe subtype of WS4 with peripheral nerve and/or central nervous system involvement, namely peripheral demyelinating neuropathy, central dysmyelinating leukodystrophy, WS, and Hirschsprung's disease or PCW/PCWH. We characterized the genetic defects underlying WS2, WS4, and the WS4-PCW/PCWH) using Sanger and whole-exome sequencing and cytogenomic microarray in seven patients from six unrelated families, including two with WS2 and five with WS4. We also performed multiple functional studies and analyzed genotype-phenotype correlations. The cohort included a relatively high frequency (80%) of individuals with neurological variants of WS4. Six novel SOX10 mutations were identified, including c.89C > A (p.Ser30∗), c.207_8 delCG (p.Cys71Hisfs∗62), c.479T > C (p.Leu160Pro), c.1379 delA (p.Tyr460Leufs∗42), c.425G > C (p.Trp142Ser), and a 20-nucleotide insertion, c.1155_1174dupGCCCCACTATGGCTCAGCCT (p.Phe392Cysfs∗117). All pathogenic variants were de novo. The results of reporter assays, western blotting, immunofluorescence, and molecular modeling supported the deleterious effects of the identified mutations and their correlations with phenotypic severity. The prediction of genotype-phenotype correlation and functional pathology, and dominant negative effect vs. haploinsufficiency in SOX10-related WS were influenced not only by site (first two vs. last coding exons) and type of mutation (missense vs. truncation/frameshift), but also by the protein expression level, molecular weight, and amino acid content of the altered protein. This in vitro analysis of SOX10 mutations thus provides a deeper understanding of the mechanisms resulting in specific WS subtypes and allows better prediction of the phenotypic manifestations, though it may not be always applicable to in vivo findings without further investigations.

Construction and analysis of recombinant eukaryotic expression plasmids for SOX10, the causative gene of Warrdenburg syndrome

Identification and Functional Analysis of A Novel Mutation in the Sox10 Gene Associated with Waardenburg Syndrome Type Iv

Molecular pathogenesis of Waardenburg syndrome type Ⅱ resulting from SOX10 gene mutation

Functional Analysis of Waardenburg Syndrome-Associated PAX3 and SOX10 Mutations: Report of a Dominant-Negative SOX10 Mutation in Waardenburg Syndrome Type II

SOX10 gene mutation screening in one Chinese family with Waardenburg syndrome type 2

[Analysis of SOX10 Gene Mutation in a Family Affected with Waardenburg Syndrome Type II].

Two novel mutations of PAX3 and SOX10 were characterized as genetic causes of Waardenburg Syndrome.

Phenotypic Similarities in Pigs with SOX10 and SOX10 Mutations Implied the Correlation of SOX10 Haploinsufficiency with Waardenburg Syndrome

Novel SOX10 Mutations in Waardenburg Syndrome: Functional Characterization and Genotype-Phenotype Analysis

Study of Gene Mutation and Pathogenetic Mechanism for a Family with Waardenburg Syndrome

A Novel Spontaneous Mutation of the SOX10 Gene Associated with Waardenburg Syndrome Type II.

Phenotypic similarities in pigs with <i>SOX10<SUP>c.321dupC</SUP></i> and <i>SOX10<SUP>c.325A>T</SUP></i> mutations implied the correlation of SOX10 haploinsufficiency with Waardenburg syndrome

Generation and expression of recombinant eukaryotic expression plasmids of MITF gene and its significance

A Model of Waardenburg Syndrome Using Patient-Derived iPSCs With a SOX10 Mutation Displays Compromised Maturation and Function of the Neural Crest That Involves Inner Ear Development

Phenotypic similarities and differences in patients with a p.Met112Ile mutation in SOX10

Novel Mutations in the Sox10 Gene in the First Two Chinese Cases of Type Iv Waardenburg Syndrome

Establishment of an Ipsc Line (Cpghi005-A) from a Patient with Waardenburg Syndrome Carrying a Heterozygous SVA-F Retrotransposon Insertion into SOX10.

High Genetic Heterogeneity in Chinese Patients With Waardenburg Syndrome Revealed by Next-Generation Sequencing

Novel Mutations of PAX3, MITF, and SOX10 Genes in Chinese Patients with Type I or Type II Waardenburg Syndrome.

A novel IRF6 gene mutation impacting the regulation of TGFβ2-AS1 in the TGFβ pathway: A mechanism in the development of Van der Woude syndrome

A Recurrent Mutation in TBPL2 Causes Diminished Ovarian Reserve and Female Infertility.