Expression of Protein Kinase C Isoforms in Retinoic Acid-Induced Differentiation of Mouse Embryonic Stem Cells into Neuron-Like Cells
Gao Qian-ying,Wu Jun-shu,Wang Zhi-chong,Ge Jian,Huang Dan-ping
DOI: https://doi.org/10.1097/00029330-200709020-00018
IF: 6.133
2007-01-01
Chinese Medical Journal
Abstract:Protein kinases C (PKCs), a big family including 12 isoenzymes, are divided into three major groups according to the variability of their regulatory domains.1,2 The classical PKCs (cPKC) including PKCα, PKCβ1, PKCβ2, and PKCγ need calcium, phosphatidylserine, and diacylglycerol or phorbol esters for full activation. The novel PKCs (nPKC) including PKCδ, PKCε, PKCη, PKCθ, and PKCμ do not require calcium for their activation. The third group is the atypical PKCs (aPKC) including PKCζ, PKCλ, and PKCι whose activation depends on phosphatidylserine but not on diacylglycerol, calcium or phorbol esters. The differences in function of specific PKC isoforms are mainly due to their different subcellular localization, activation or inhibition by different stimuli, and transcriptional regulation. Embryonic stem (ES) cell lines are potentially capable of being maintained in a pluripotent state in the presence of leukemia inhibitory factor (LIF) and can induce a high proportion of neurons and glia when treated with all-trans retinoic acid in vitro.3 However, it is not yet clear whether PKCs could express in ES cells and in neuron-like cells induced from ES cells. Therefore, data regarding the precise pattern of PKC isoenzymes expression in ES cells and in neuron-like cells could be informative with regard to their physiological regulation and potential role in cellular differentiation. The present study was designed to explore the dynamic profile of the five major kinds of PKC isoenzymes in the retinoic acid-induced differentiation of ES cells into neuron-like cells in mouse as a step towards elucidating their roles in differentiation. METHODS Culture of undifferentiated ES cells Mouse ES cell line D3 was obtained from Professor HUANG Bing (Sun Yat-sen University, Guangzhou, China). Ten to thirteen passages of ES-D3 cells were grown in a humidified 37°C incubator in an atmosphere of 5% CO2 and cultured in Hepes-buffered Dulbecco's Modified Eagle's Medium (DMEM) containing 15% selected fetal bovine serum, 0.1% b-mercaptoethanol, and 1 U/ml leukemia inhibitory factor (LIF) on 0.1% gelatin-coated dishes.4 The medium was changed daily and cells were passaged every 2 days. Induction of differentiation of ES cells Based on the methods previously reported,5,6 ES cells were subjected to an 18-day-induction procedure which consisted of 4 days of culture as embryoid bodies (EBs) without retinoic acid (Sigma, USA) followed by 14 days of culture in the presence of retinoic acid. This protocol is referred to as 4−/14+ treatment. For control, 4-day aggregates were cultured for additional 14 days in the absence of retinoic acid. These were referred to as 4−/14− treatment. The 4-day-old EBs were plated separately onto gelatin-coated six-well culture dishes coated glass coverslip for immunohistochemistry, 100 mm-diameter bacteriological (non-tissue culture) dish for Western blot, onto 60 mm-diameter tissue culture plates for reverse transcription polymerase chain reaction (RT-PCR). At this time, the medium was changed into standard medium lacking LIF and b-mercaptoethanol and supplemented with 5×10-7 mol/L retinoic acid, then cells were cultivated and collected for 1, 3, 5, 7 and 14 days in the presence of retinoic acid. After 2 additional days the medium was exchanged for fresh medium with retinoic acid for treated cultures but without retinoic acid for controls. Antibody staining ES cells and differentiated cells were grown on six-well glass slides separately and fixed in acetone. Then they were carried out with Immunostain Elivision Kit (Mai Xin Biotechnology Co., China) following the manufacturer's protocol. After washed in PBS, cells were incubated in 1% H2O2 solution at room temperature for 10 minutes to quench endogenous peroxidases. Nonspecific binding was blocked with 5% normal horse serum at room temperature for 5 minutes. The cells were then incubated with anti-mouse-PKCα, PKCβ, PKCγ, PKCδ, PKCε, neuron specific enolase (NSE) and neurofilament (NF)-200 monoclonal antibody (BD Transduction Laboratories, USA) at a 1:200 dilution at 4°C overnight. Following washed in PBS, the secondary antibody (goat anti-rabbit horse radish peroxidase, BD Transduction Laboratories) was added and the cells were incubated at room temperature for 1 hour, and detected with DAB. For control, the antibody was replaced by PBS. After immunoperoxidase staining, the slides were observed by light microscope. At least five view fields were observed per slide, cells showing brown-yellow color in the cytoplasm and membrane were identified as positive. Western blot analysis Western blotting was carried out as previously described.7 After retinoic acid treatment, the cells were lysed in digitonin-Triton lysis buffer and scraped from the culture dish with a cell scraper. Lysates were homogenized for 10 seconds at 6000 r/min in a homogenizer. Protein concentration was determined by the Bio-Rad protein assay (Bradford method). For detection of PKC isoforms in crude cell lysates, an equal amount of total cell lysates (100 μg) was solubilized in sample buffer by boiling for 5 minutes and subjected to 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) followed by electrotransfer onto a nitrocellulose filter. Then the blots were blocked for 30 minutes at 37°C in PBS (pH 7.3) containing 1% BSA. Followed by incubation with anti-PKCα, PKCβ, PKCγ, PKCδ, PKCε monoclonal antibody (BD Transduction Laboratories), 2 μg/ml in dilution buffer (PBS containing 1% BSA and 0.05% Tween 20) for 1 hour at 25°C with constant mixing. The blots were then washed three times in PBS for 5 minutes each and then incubated for 3 hours in dilution buffer containing 0.4 μg/ml HRP-conjugated goat anti-rabbit IgG. The bound HRP was visualized with DAB. Mouse brain extract was used as positive control. RT-PCR Total RNA was extracted using TRIZOL reagent (Sigma) as described by Geng et al.8 PKCα: 5′ primer, ATCCGCAGTGGAATGAGTCCTTTACAT; 3′ primer, TTGGAAGGTTGTTTCCTGTCTTCAGAG. Primer sequences for PKCβ, PKCγ, and PKCδ can be found in previous study.9 Primer sequences for PKCε were obtained from mouse PKC cDNA located in GenBank: PKCε: 5′ primer, CAAAATCTGCGAGGCCGTGAGG; 3′ primer, GCATCCGCTCCCTAAACACTCG. Each primer set could amplify the proper size band from 1:1000 dilution of cDNA product from an RT reaction of 1 μg total RNA isolated from pluripotent ES cells. The PCR products were analyzed on 1.2% agarose gels and visualized by ethidium bromide staining. RESULTS Retinoic acid simulates the appearance of cells with neuron-like morphology At the first day, few cells grew out neuritis. By 3 days post-plating, many of the 4−/14+ aggregates give off extensive outgrowths of neurites, the neuron-like cells have small cell bodies with several long neurites emerging from them. In contrast, far fewer 4−/14− aggregates have outgrowths of neurites. There is a noticeable difference between 4−/14+ and 4−/14− culture. By day 7 the neuron-like cells established connection among themselves, and thus initiated the formation of an interneuronal network (Fig. 1). Cultures from 4−/14− aggregates consist mostly of flat cells with very few neurons. By day 14, the neuron-like cells died and the culture consists of a population of flat cells adhering to the substrate loosely.Fig. 1.: Neuritic outgrowth from retinoic acid-treated culture (A, original magnification × 200). ES-D3 cells grew on the feeder layer (B), neuron-like cells at day 7.Identification of PKC isoenzymes in the ES cells and neuron-like cells Immunohistochemical studies demonstrated that PKCα was constantly expressed in stem cells especially in the cytoplasm and membrane and the arising cell types. PKCδ was detected in all differentiated cell types, whereby PKCβ, PKCγ, and PKCε were solely found in the neuronal derivatives. In order to determine whether the neuron-like cells contain neuron-associated proteins, at 7th day after plating, the cultures were fixed and stained with anti-NF-200 and NSE antibodies which are highly restricted to neurons. Most of the neuron-like cells stained with anti-NF-200 and NSE antibody. Some of the neuron-like cells were not stained or stained very faintly. This could be due either to expression of NF-200 being restricted to a subset of the neuron-like cells or to lower sensitivity of the antibody. Western blot analysis The supernatants of the cell cultures were analyzed for PKC isoforms by Western blot to confirm the identity of the protein products at day 1, day 3, day 5, day 7 and day 14. PKCα, PKCβ, PKCγ, PKCδ, and PKCε in the ES-D3 cells were tested by immunoblotting which identified bands with molecular weight of about 84, 80, 80, 78, 90 kD respectively. After induced by retinoic acid, PKCα expression was down-regulated rapidly at first, then was found slightly higher; PKCβ and PKCγ were constitutively expressed; PKCδ and PKCε was up-regulated three days after addition of retinoic acid. PKC isoforms α, δ, and ε resumed to original levels at day 7 when the major phenotypical alteration process of the developing neurons was completed (Fig. 2, Table 1).Fig. 2.: Retinoic acid-induced alterations in the expression of ES cells PKC isoforms. Each gel was loaded with 20 μg of protein. The PKC isoforms represented in the above blots are as follows: (A) PKCα (84 kD), (B) PKCβ (80 kD), (C) PKCγ (80 kD), (D) PKCδ (78 kD), (E) PKCε (90 kD).Table 1: Western analysis of ES cells induced by retinoic acidExpression of PKC isoforms gene induced by retinoic acid RNA of cells were extracted and analyzed by RT-PCR several days after retinoic acid was added to ES cells. Products obtained with PKC isoforms primers were consistent with the expected size and identical to the products obtained with RNA. Similar level of products using β-actin primers were seen in all of the samples. Although similar results of PKC isotypes gene expression occurred, they did not fully recapitulate protein expression. RT-PCR results showed that in the ES cells, mRNAs coding for PKCα, PKCβ and PKCε were present, while mRNAs coding for PKCγ and PKCδ were not detected. PKCα transcription level decreased dramatically on the first day after induction, then rose slowly and resumed on 14th day. Three days after addition of retinoic acid, mRNAs coding for PKCγ and PKCδ were firstly detected and PKCβ, PKCγ, and PKCδ were constitutively expressed. The protein level of PKCε resumed to original range after seven days when the major phenotypical alteration process of the developing neurons was completed. RT-PCR results were summarized in Table 2.Table 2: RT-PCR analysis of ES cells induced by retinoic acidDISCUSSION It was showed that ES cells were capable of differentiating into neuron-like cells expressing multiple phenotypes, each of which was usually associated with neuronal cells.5 It was considered important to designate the differentiated cells as “neuron-like” cells rather than true neurons. Our results were consistent with the previous studies that about 38% of the cells in cultures were neuron-like cells in morphology. Some PKC isotypes appear to function in the ES cells differentiation process. Marchisio et al10 proposed that the down-regulation of most classical PKCs may be required for the induction of erythroid differentiation, as weak expression of PKCα, PKCβ1, PKCβ2 and PKCγ were observed. Of these PKC isoforms, PKCα is distributed ubiquitously in almost all tissues and plays an important role in the growth and malignant progression of some tumor cell lines and differentiation. Recently, Zhou et al11 analyzed specific stages of EB differentiation using highly specific pharmacological, biochemical, and microscopic analyses and found that inhibition of PKCβ and PKCζ in cooperation with increased PKCε protein and its activation are critical, final, spatio-temporal steps involved in the differentiation process of cardiomyocytes from ES cells. Oehrlein et al12 demonstrated that multipotent PCC7-Mz1 embryonic carcinoma stem cells could develop into a tissue-like pattern of neuronal, fibroblast-like and astroglial cells by retinoic acid treatment. Western blot analyses demonstrate that PKCα, PKCβ1, PKCγ, PKCθ, PKCμ, PKCλ and PKCζ were constitutively expressed but expression of PKCβ2, PKCδ, PKCε were up-regulated three days after addition of retinoic acid when the cells matured in morphology. PKC isoforms PKCβ2, PKCδ expression decreased after 6th day when the major phenotypical alterations of the developing neurons were completed, PKCε expression remained at a high level. These data showed that the cell type-specific expression, subcellular localization and activation of PKCs were regulated in an isoform-specific manner during neurogenesis, suggesting that they were involved in the control of neural development and especially in neuronal differentiation. In the current study, we investigated the expression of PKC isoforms in the differentiation of ES cells into neuron-like cells induced by retinoic acid. Similar characteristic expression of PKC isoforms was found along the neuronal pathway. Retinoic acid could induce the change of PKC isoforms expression in ES cells and in retinoic acid-treated, differentiated cells. This was demonstrated at the transcriptional level using RT-PCR and at the translational level using immunostaining and Western blotting. It seemed that the level of PKCα, PKCγ, PKCδ, and PKCε were related to the amounts of neuron-like cells. Interestingly, protein expression did not fully recapitulate gene expression. PKCγ and PKCδ gene expression, for example, were undetectable in ES cells, while their respective protein products level remained relatively the same after 3rd day. This finding did not come as a complete surprise, though, as PKCα and δ isotypes have been shown to persist for days without gene expression in other systems, such as in early pre-implantation mammalian embryos. It appears that some PKC proteins are more stable, or simply not targeted for degradation as quickly as others (i.e., PKCβ).9 Taken together, the morphological, immunological, and molecular data of our study argued that PKCα, PKCγ, PKCδ and PKCε were probably involved in neuronal differentiation of ES cells and played a very important role in retinoic acid-induced differentiation into neuron-like cells. This study was characterized by the PKC isoenzymes profile in retinoic acid-induced differentiation of ES cells into neuron-like cells which suggested that defining the cell-specific isoenzyme pattern was an important step into understanding their precise physiological role and regulation in the process of differentiation.