First report of Citrus tristeza virus in Citrus changshanensis cv. Huyou in Zhejiang, China

Xiaofei Cheng,Jianxiang Wu,X. Y. Ma,H. F. Fu,Xiaoyun Wu

IF: 2.2

2011-01-01

Journal of Plant Pathology

Abstract:null

What problem does this paper attempt to address?

[Studies on Chemical Constituents in the Peels of Citrus Changshan-Huyou (I)].

Xue-mei Zhao,Xing-qian Ye,Yu-fang Xi,Da-yuan Zhu,Shan-hao Jiang

DOI: https://doi.org/10.3321/j.issn:1001-5302.2003.03.015

2003-01-01

Abstract:Objective To further study on the chemical constituents in the peels of Citrus changshan-huyou.Methods The chemical constituents were separated by repeated silica gel column chromatography,the structures were determined by spectral analyses.Results Ten compounds were obtained and identified as huyoujiasu(2'-hydroxy-malonyl-3,4-dihydroxybenzoic acid,Ⅰ),3'-hydroxy-4',5,6,7,8-pentamethoxyflavone(Ⅱ),eriodictyol(Ⅲ),tetracosanoic acid(Ⅳ),glyceryl dodecanoate(Ⅴ),neoeriocitrin(Ⅵ),naringin(Ⅶ),neohesperidin(Ⅷ),4-methoxy-3-hydroxybenzoic acid(Ⅸ),and 3,4-dihydroxybenzoic acid(Ⅹ).Conclusion 2'-hydroxy-malonyl-3,4-dihydroxybenzoic acid is a new compound and the above ten compounds are obtained from this plant for the first time.
[Isolation and Identification of Chemical Constituents from Peels of Citrus Changshan-Huyou Y.B. Chang].

Xue Mei Zhao,Xing Qian Ye,Da Yuan Zhu

DOI: https://doi.org/10.3969/j.issn.1671-167x.2009.05.015

2009-01-01

Abstract:OBJECTIVE:To study the chemical constituents of the peels collected from Citrus changshan-huyou Y. B. Chang, and further screen the bioactive components as the lead structures.METHODS:These compounds were isolated by repeated flash column chromatography on silica gel and Sephadex LH-20. The structures of isolated compounds were elucidated by using IR, EIMS, and NMR analyses.RESULTS:One novel compound along with nine known compounds were obtained and identified as huyoujiasu(I), 3-hydroxy-4-methoxybenzoic acid(II), 3, 4-dihydroxybenzoic acid(III), fatty acid(IV), glyceride(V), 6, 7-dimethoxycoumarin(VI), 6', 7'-dihydroxybergamottin(VII), daucossterol A(VIII), daucossterol B(IX) and huyou-triterpenoid(X).CONCLUSION:One new compound, Huyoujiasu, was obtained from these peels by repeated column chromatography, and the other known compounds were isolated from this fruit for the first time as well.
A novel compound isolated from the peels of Citrus changshan-huyou Y.B.Chang

Xue-mei ZHAO,Xing-qian YE,Da-yuan ZHU

DOI: https://doi.org/10.3321/j.issn:0513-4870.2008.12.008

2008-01-01

Abstract:Five compounds, huyouyisu (1), vomifoliol (2), isoferulic acid (3), 1,2,3-trihydroxy-phenol (4) and p-hydroxy-phenol (5), were isolated from the peels of Citrus changshan-huyou Y.B.Chang for the first time by utilizing repeated column chromatography on silica gel. Among them, huyouyisu (1) is a new compound. The structure was elucidated by using 1D and 2D spectra.
Phyllosticta Species Associated with Citrus Diseases in China

Xinghong Wang,Guoqing Chen,Feng Huang,Jingze Zhang,Kevin D. Hyde,Hongye Li

DOI: https://doi.org/10.1007/s13225-011-0140-y

IF: 24.902

2011-01-01

Fungal Diversity

Abstract:Phyllosticta species associated with diseases of four commercial Citrus species grown in China are reported. Totally, 496 Phyllosticta strains were isolated from mandarins ( Citrus reticulata ), pomeloes ( C. maxima ), oranges ( C. sinensis ) and lemons ( C. limon ) in the main citrus producing regions across China, and 74 strains were selected for phylogenetic analysis. Analyses inferred from the sequences of internal transcribed spacer region (ITS1, 5.8S nrDNA and ITS2), partial translation elongation factor 1-alpha (TEF1) and partial actin gene (ACT), showed these representative Phyllosticta isolates clustered in four distinct clades corresponding to three known, and one undescribed species. The newly resolved taxon, Phyllosticta citrichinaensis was isolated from leaves and fruits of all four Citrus species and is introduced in this paper. This taxon caused minor damage, showing irregular spots or freckles. Phyllosticta citriasiana, associated with tan spot of pomeloes, was isolated only from pomeloes, and never from lemons, mandarins and oranges. Phyllosticta citricarpa, the citrus black spot pathogen, which is presently subjected to phytosanitary legislation in the EU and United States, was isolated from lemons, mandarins and oranges, but never from pomeloes. The isolates of P. citricarpa clustered in two subclades, one from mandarins, the other from oranges and lemons. P. capitalensis was isolated from all four Citrus species as an endophyte, causing false melanose, or together with P. citricarpa or P. citriasiana . Morphological, cultural and biochemical characters were consistent with the results of phylogenetic analysis. In addition, a specific primer pair Pca8/ITS4 was designed and selected, and its corresponding PCR procedure was developed for the detection of P. citriasiana in this study.
A Destructive New Disease of Citrus in China Caused by Cryptosporiopsis Citricarpa Sp. Nov.

Li Zhu,Xinghong Wang,Feng Huang,Jinze Zhang,Hongye Li,Dekuan Ding,Kevin D. Hyde

DOI: https://doi.org/10.1094/pdis-09-11-0775

IF: 4.5

2012-01-01

Plant Disease

Abstract:Defoliation, dieback and mortality of Satsuma mandarin (Citrus unshiu), as well as kumquat (Fortunella margarita), in Chenggu County, Shaanxi Province, China was first noticed in 2006 and caused substantial economic losses to citrus production. The incidence of leaves infected approached 100% in some badly infected orchards. The disease prevailed only in late winter and early spring, where early symptoms were rounded and target-like spots on leaves. The disease was named target spot. Black conidiomata were observed on the upper surface of the leaves. A Cryptosporiopsis species was consistently recovered from the infected leaves, shoots, and branches. Koch's postulates were fulfilled by inoculating the conidial suspension of Cryptosporiopsis sp. onto the leaves of Satsuma mandarin. Phylogenetic analysis based on LSU sequence data indicated that this taxon clustered in Cryptosporiopsis (teleomorph: Neofabraea, Dermateaceae). Phylogenetic analysis based on ITS, SSU, and TUB indicated that the isolates of Cryptosporiopsis sp. constituted a distinct clade. Further study also demonstrated that this taxon was morphologically distinct from other species of Cryptosporiopsis, thus suggesting it might belong to an undescribed species. The name Cryptosporiopsis citricarpa sp. nov. is given to accommodate the fungal pathogen in this study.
Identification of Hop stunt viroid infecting Citrus limon in China using small RNAs deep sequencing approach

Xiu Su,Shuai Fu,Yajuan Qian,Yi Xu,Xueping Zhou

DOI: https://doi.org/10.1186/s12985-015-0332-2

IF: 5.916

2015-01-01

Virology Journal

Abstract:The advent of next generation sequencing technology has allowed for significant advances in plant virus discovery, particularly for identification of covert viruses and previously undescribed viruses. The Citrus limon Burm. f. (C. limon) is a small evergreen tree native to Asia, and . China is the world’s top lemon-producing nation.
First Report and New Hosts of Pseudofabraea Citricarpa Causing Citrus Target Spot in China

Xiaoe Xiao,Yating Zeng,Wen Wang,Lan Cheng,Xinghua Qiao,Xin Hou,Hongye Li

DOI: https://doi.org/10.1094/php-07-20-0056-rs

2021-01-01

Plant Health Progress

Abstract:Citrus target spot, caused by Pseudofabraea citricarpa (Zhu et al.) Chen, Verkley & Crous, was a recently reported disease on satsuma mandarin and kumquat in Chenggu (Shaanxi province, China). In January 2019, target spot-like disease was also observed on 'Eureka' lemon and 'Beijing' lemon in Wanzhou (Chongqing province), satsuma in Yichang (Hubei province), and 'Ponkan' in Jishou (Hunan province). The identity of the causative agent was conducted and confirmed as P. citricarpa based on symptoms, fungal morphology, and multigene phylogenetic analysis, as well as pathogenicity tests. Investigations revealed that P. citricarpa can also infect 'Tarocco' blood orange and 'Newhall' navel orange. It can not only infect leaves and shoots but also can infect fruits. These results suggest that P. citricarpa could potentially spread to other citrus-growing regions in China.
Monoclonal Antibody-Based Serological Methods for Detecting Citrus Tristeza Virus in Citrus Groves

Zhen Liu,Zhe Chen,Jian Hong,Xuefeng Wang,Changyong Zhou,Xueping Zhou,Jianxiang Wu

DOI: https://doi.org/10.1007/s12250-016-3718-4

2016-01-01

Abstract:Citrus tristeza virus（CTV） is one of the most economically important citrus viruses and harms the citrus industry worldwide.To develop reliable and effective serological detection assays of CTV,the major capsid protein（CP） gene of CTV was expressed in Escherichia coli BL21（DE3） using the expression vector p ET-28 a and purified through Ni + -NTA affinity chromatography.The recombinant protein was used to immunize BALB/c mice.Four hybridoma cell lines（14B10,14H11,20D5,and20G12） secreting monoclonal antibodies（MAbs） against CTV were obtained through conventional hybridoma technology.The titers of MAb-containing ascitic fluids secreted by the four hybridoma lines ranged from 10-6 to 10-7 in indirect enzyme-linked immunosorbent assay（ELISA）.Western blots showed that all four MAbs could specifically react with CTV CP.Using the prepared MAbs,dot-ELISA,Tissue print-ELISA,and triple antibody sandwich（TAS）-ELISA were developed to detect CTV in tree nurseries and epidemiological studies.The developed dot-ELISA and TAS-ELISA methods could detect CTV in crude extracts of infected citrus leaves with dilutions of 1:2560 and1:10,240（w/v,g/m L）,respectively.Tissue print-ELISA was particularly useful for large-scale field sample detection,mainly owing to its simplicity and lack of sample preparation requirements.The field survey revealed that CTV is prevalent on citrus trees in the Chongqing Municipality,Jiangxi Province,and Zhejiang Province of China.The coincidence rate of serological and RT-PCR test results reached more than 99.5%.The prepared MAbs against CTV and established sensitive and specific serological assays have a significant role in the detection and prevention and control of CTV in our country.
Identification of the Pathogenic Fungus Causing Brown Spot on Tangerine( Citrus Reticulata CV.Hongjv

CHEN Chang-sheng,HUANG Feng,CHENG Lan,FENG Chun-gang,HUANG Tao-jiang,LI Hong-ye

DOI: https://doi.org/10.13926/j.cnki.apps.2011.05.001

2011-01-01

Abstract:An unknown has been breaking out and causing a great loss on Hongjv(Citrus reticulata Blanco,CV.Hongjv) since 2007 in Wanzhou,Zhongqing,China.The was characterized as the spot on affected tissues and named brown spot disease temporarily.The occurs around a growing season and the severe affected leaves and fruits drop quickly.To determine the causing agent,the infected leaves,fruits and shoots were collected from different orchards.Typical conidiospores and cultures of Alternaria and Colletotrichum were always observed and isolated from infected tissues.However,pathogenicity test showed that only the isolates of Alternaria were pathogenic to the leaves and fruits of tangerine(Ci.reticulata CV.Ponkan).Based on the study of morphology,cultural feature and partial sequence of an endopolygalacturonase gene(endoPG),the pathogenic Alternaria was identified as A.alternate(Fr.) Keissler.The clarification of pathogen would benefit to the study on epidemiology and control of this disease.
First Report of citrus virus A infecting citrus (Citrus reticulata Blanco) in China

Xinying Yang,Qiangsheng Xu,Zheng Liu,Changyong Zhou,Mengji Cao

DOI: https://doi.org/10.1094/PDIS-06-22-1344-PDN

2022-12-05

Abstract:Citrus is one of the most popular fruit crops in the world. Citrus virus A (CiVA, species Coguvirus eburi, genus Coguvirus) is a newly identified virus (Navarro et al. 2018) with two negative-sense single-stranded RNAs (RNA1 and RNA2). To date, CiVA has been detected on different citrus species in South Africa, U.S.A. and Greece (Bester et al. 2021; Park et al. 2021; Beris et al. 2021). CiVA has not been reported in China. In Sept. 2018, virus-like symptoms of leaf mottling, leaf flecking, and oak leaf patterns were observed on 'Orah' mandarin (Or) and 'Harumi' tangor (Ht) trees grown in Neijiang (NJ, Sichuan Province) and on Citrus reticulata cv.'Jinqiushatangju' (Jq) trees in Guizhou Province (GZ). Two mixed leaf samples (HY-NJ: 1 Or and 1 Ht and GZ-1: 2 Jq) were collected from symptomatic trees and then subjected to high-throughput sequencing (HTS). Total RNA was extracted by TRIzol. The cDNA library was constructed after depleting ribosomal RNA using a TruSeq RNA Sample Prep Kit and sequenced by Illumina HiSeq X-ten platform with paired-end reads length of 150 bp. After removing adaptors, low-quality reads, and reads homologous to citrus hosts by CLC Genomics Workbench 11 (Qiagen, U.S.A.), 917,547 and 1,508,134 clean reads were obtained from 56,239,772 and 81,535,900 total reads for HY-NJ and GZ-1, respectively. De novo assembly of the clean reads by CLC Genomics Workbench 11 resulted in 2,181 contigs for HY-NJ and 3,718 contigs for GZ-1. BLASTX searches of the contigs against local virus (taxid:10239) and viroid datasets (taxid:2559587) downloaded from NCBI allowed identification of several viruses and viroids. CiVA, citrus leaf blotch virus, citrus yellow vein clearing virus (CYVCV), and citrus psorosis virus (CPsV) were detected in HY-NJ. CiVA, hop stunt viroid, citrus viroid VI, citrus viroid V, citrus exocortis viroid, citrus dwarfing viroid, citrus bent leaf viroid, citrus bark cracking viroid, CYVCV, citrus tristeza virus, apple stem grooving virus, and CPsV were also detected in GZ-1. The lengths of the CiVA contigs were 6,682-nt and 6,670-nt matching RNA1 and 2,728-nt and 2,715-nt matching RNA2, respectively. The average coverage depth of clean reads mapped to CiVA-related contigs in HY-NJ was 64.90 and 156.54 for RNA1 and RNA2, respectively, and 26.50 and 558.08 in GZ-1. The full-length genomes of CiVA in HY-NJ and GZ-1 were determined by Sanger sequencing of six overlapping cDNA fragments obtained by RT-PCR and 5' and 3' RACE. At least 5 molecular clones were randomly selected for each fragment. The NJ isolate had a 6,690 nt RNA1 (GenBank accession no. MZ436805) and a 2,740 nt RNA2 (MZ436807). The GZ isolate had a 6,688 nt RNA1 (MZ436804) and a 2,734 nt RNA2 (MZ436806). BLASTN showed that the NJ and GZ isolates have 99.31 to 99.60% sequence identity to the isolate CG301 (MT922052; MT9220523). A phylogenetic tree constructed from nucleotide sequences indicated that the NJ and GZ isolates are closely related to the CG301 isolate. Among 105 citrus samples (35 Or and 30 Ht from NJ and 50 Jq from GZ) randomly collected, 11 samples (4 Or, 2 Ht and 5 Jq) with similar symptoms tested positive by RT-PCR using generic primers designed from conservative regions of RNA2 (F: TTGCAGTAGTGAGAAGGGAGT; R: TCAAAAGAGGCAGTGGTAGGA). To our knowledge, this is the first report of CiVA infecting citrus trees in China. The results will help facilitate further research to assess the threat of CiVA to citrus growing areas in China.
Complete Genome Sequence of a Novel Variant of Citrus Tristeza Virus Infecting Chinese Wild Mandarin (citrus Daoxianensis S.W. He & G.F. Liu., Syn. Citrus Reticulata Blanco) in China

Shuanghua Li,Jun Zhou,Long Yi,Aijun Huang,Rongyan Han,Ping You

DOI: https://doi.org/10.1007/s40858-023-00566-9

2023-01-01

Tropical Plant Pathology

Abstract:A putative new variant of citrus tristeza virus (CTV), JY-2, was identified in Chinese wild mandarin ( Citrus daoxianensis S.W. He & G.F. Liu., syn. Citrus reticulata Blanco) by RT-PCR and high-throughput sequencing (HTS) of RNA sequencing (RNA-seq) data. The complete genomic sequence consisted of 19,112 nucleotides (nt). JY-2 shared the highest 89.4% of its genomic nt sequence, highest 90.4% of its ORF1a nt sequence, and highest 90.7% of its ORF1a amino acid sequence with CN-M1-ZT1. Phylogenetic analyses of complete genomic, ORF1a to ORF1b, and p33 to p23 nt sequences showed that JY-2 occupied a separate clade distinct from other existing CTV genotypes, suggesting that JY-2 is a new variant. RT-PCR analysis showed that JY-2 was exclusively found in Chinese wild mandarin trees from Jiangyong (Hunan Province). The current findings aid in understanding of the molecular diversity of CTV and give insights into its evolution.
First report of Neopestalotiopsis rosae causing leaf blight on Shatangju in southern China

Xiaofang Ma,Ying Qin,Yiyuan Xiang,Ligang He,Fang Song,Zhijing Wang,Yingchun Jiang,Liming Wu

DOI: https://doi.org/10.1094/PDIS-09-22-2066-PDN

2023-02-13

Abstract:Shatangju (Citrus reticulata Blanco cv. Shatangju) belongs to genus Citrus and was cultivated extensively in southern China. In April 2022, a leaf blight-like symptom (firstly brown spots appeared on infecting leaves, then these brown spots extended, finally the whole leaves displayed blight-like symptom) was observed on 5%~10% of Shatangju seedlings (around five hundreds in total) in an orchard located in Wuhan city, Hubei, China. Diseased leaves from three seedlings were collected and cut into pieces (0.2 to 0.5 cm). These pieces were surface-sterilized using 75% ethanol for 3 min, rinsed with sterile distilled water for several times, then placed on potato dextrose agar (PDA) and incubated at 26°C with 12-h light/dark cycle. Over 20 pieces plated, wherein 30% were identified as Colletotrichum fructicola, 60% as Neopestalotiopsis spp., and 10% developed saprophytes. C. fructicola was a known pathogen on citrus, thus Neopestalotiopsis spp. was further investigated. Eight single-conidium colonies of the Neopestalotiopsis spp. were obtained, wherein STJ-8 was chosen as a representative for further study. The average growth rate of STJ-8 was 15.1±0.5 mm/day (n=5). Fungal colonies produced white cottony mycelium with abundant black acervuli distributed in concentric rings 6-8 days after planting, which ranged from 342.3 to 710.5 μm in diameter (n=100). Conidia were fusoid, five cells, four septa with average dimensions of 25.36×5.47 μm (n=100). Basal and apical cells were hyaline, wherein three middle cells were brown with darker septa. The apical cell was cylindrical with two to three transparent accessory filaments (13.7 to 30.5 µm in length, n=80). Basal cell was conic with an appendage (4.1 to 8.8 µm in length, n=40). Partial sequences of internal transcribed spacer (ITS), translation elongation factor 1-alpha (TEF-1α), and β-tubulin (TUB2) were amplified with reported primers (White et al. 1990; Lee et al. 2006; Maharachchikumbura et al. 2014), sequenced, and submitted to GenBank (accession nos. ITS: OP236541; TEF-1α: OP250124; TUB2:OP263094). BLASTn results showed 100% identity with the corresponding sequences of Neopestalotiopsis rosae. A multilocus phylogenetic analysis showed STJ-8 was closest to N. rosae. Thus, STJ-8 was identified as N. rosae. Pathogenicity tests were performed on one-year-old Shatangju seedlings and detached primary leaves by inoculating needle-wounded leaves with seven days old 5-mm mycelial plugs/acervuli (about 5000 spores) of STJ-8. Control seedlings/leaves were inoculated with 5-mm PDA plugs/sterile water drops. All inoculated detached leaves were cultured at same the place with STJ-8 cultured, while inoculated seedlings were put in a growth chamber at 26°C under a 16-h light/dark cycle (60% humidity). Symptoms developed on all inoculated leaves (except healthy control) 2 and 4 days post-inoculation by mycelial plugs and acervuli, respectively. N. rosae was re-isolated from the inoculated leaves, confirming Koch's postulates. N. rosae has been reported to cause diseases on various plants worldwide (Rebollar-Alviter et al. 2020; Xavier et al. 2021; Lawrence et al. 2022). In China, N. rosae has been reported to cause leaf spot/blight on pecan and strawberry (Wu et al. 2021; Gao et al. 2022), which caused great loss on these crops. To our knowledge, this is the first report of N. rosae causing leaf disease on citrus. Our study is important for developing control strategies against N. rosae in future.
Bayesian phylodynamic analysis reveals the evolutionary history and the dispersal patterns of citrus tristeza virus in China based on the p25 gene

Changning Wang,Chaoyun Chen,Yiqun Chen,Ke Zhong,Long Yi

DOI: https://doi.org/10.1186/s12985-023-02190-0

IF: 5.916

2023-10-05

Virology Journal

Abstract:Citrus tristeza virus (CTV) is one of the most serious threats to the citrus industry, and is present in both wild and cultivated citrus. The origin and dispersal patterns of CTV is still poorly understood in China.

virology
First Report of Citrus Leaf Blotch Virus in Sweet Cherry.

J. Wang,D. Zhu,Y. Tan,X. Zong,H. Wei,Q. Liu

DOI: https://doi.org/10.1094/pdis-09-15-0965-pdn

IF: 4.5

2016-01-01

Plant Disease

Abstract:HomePlant DiseaseVol. 100, No. 5First Report of Citrus leaf blotch virus in Sweet Cherry PreviousNext DISEASE NOTES OPENOpen Access licenseFirst Report of Citrus leaf blotch virus in Sweet CherryJ. Wang, D. Zhu, Y. Tan, X. Zong, H. Wei, and Q. LiuJ. Wang, D. Zhu, Y. Tan, X. Zong, H. Wei, and Q. LiuAffiliationsAuthors and Affiliations J. Wang D. Zhu Y. Tan X. Zong H. Wei Q. Liu , Key Laboratory for Fruit Biotechnology Breeding of Shandong Province, Shandong Institute of Pomology, Tai'an, Shandong 271000, China. Published Online:25 Feb 2016https://doi.org/10.1094/PDIS-09-15-0965-PDNAboutSectionsSupplemental ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat In May 2014, five symptomatic sweet cherry trees (Prunus avium L. cv. Red-lamp), one with severe and four with mild mosaic symptoms, were found in the orchard at the suburb of Tai'an, Shandong Province, China. Total RNA was extracted from young leaf samples of the five symptomatic trees and three symptomless trees. Total RNA from the severely symptomatic tree was used for small RNA (sRNA) library construction. RNAs of <50 nt were purified from 6% polyacrylamide and sequenced on an Illumina HiSeq2000. Raw sequencing reads were analyzed using a CLC Genomics Workbench 7.5 (CLCbio, Aarhus, Denmark). After removal of the host sRNAs (database constructed by sweet cherry RNA-seq sequence libraries deposited in NCBI), 301 contigs (>100 nt) were assembled (length fraction, 0.94; similarity fraction, 1.0). BLASTn searches at NCBI (nonredundant nucleotide database) revealed contigs similar to Cherry virus A (CVA, 56 contigs), Prunus necrotic ringspot virus (PNRSV, 13 contigs), Little cherry virus 1 (LChV-1, two contigs) and Citrus leaf blotch virus (CLBV, three contigs). CVA, PNRSV, and LChV-1 infections of sweet cherry have been reported in China (Lu et al. 2015; Zong et al. 2014), but not CLBV. RT-PCR confirmed the CVA, PNRSV, and LChV-1 infections in the tree (Lu et al. 2015; Zong et al. 2014). To verify CLBV infection, primers (CLBV-F: GCCTACAGTTTAAGTGAGAGGCT and CLBV-R: GTCTAAAAGTTCTTAAAAGACATC) were designed according to the determined sequence and used to amplify a DNA fragment covering the movement protein (MP) and coat protein (CP) genes of CLBV by RT-PCR. A 2.9-kb DNA fragment was amplified from the tree with severe symptoms, from two of the four mild symptomatic trees, and from one of the symptomless trees. The amplicon from the tree exhibiting severe symptoms was cloned into pMD18-T (Takara, Dalian, China). Six clones were sequenced (Invitrogen, Beijing, China) and found to be 99.9 to 100% identical. One sequence was deposited in GenBank as Accession No. KT373979. This sequence was mapped to 3229 reads (approximately 26-fold coverage) with an average length of 23.6 nt (length fraction, 0.94; similarity fraction, 1.0). Phylogenetic analysis of the CP sequences of CLBV isolates in GenBank and other Betaflexiviridae family members using MEGA6.0 (Tamura et al. 2013) showed that the cherry isolate was most closely related to a citrus isolate (NC_003877, type isolate) and a kiwi isolate (JN900477). With other isolates, they formed a cluster distinct from other viruses of Betaflexiviridae. The CP gene of the cherry isolate shares 87.6% and 88.3% sequence identity with the citrus and kiwi isolates, respectively, indicating that it is a distinct variant of CLBV. Its MP gene shares higher identities (citrus, 95.6%; kiwi, 94.2%). Thus, CLBV can infect sweet cherry, and the sweet cherry isolate is a novel strain. To our knowledge, this is the first report of the CLBV infection in sweet cherry trees.References:Lu, M. G., et al. 2015. Plant Dis. 99:1191 https://doi.org/10.1094/PDIS-11-14-1200-PDN. Link, ISI, Google ScholarTamura, K., et al. 2013. Mol. Biol. Evol. 30:2725. https://doi.org/10.1093/molbev/mst197 Crossref, ISI, Google ScholarZong, X. J., et al. 2014. Sci. Hortic. (Amsterdam) 180:118. https://doi.org/10.1016/j.scienta.2014.10.017 Crossref, ISI, Google ScholarDetailsFiguresLiterature CitedRelated Vol. 100, No. 5 May 2016SubscribeISSN:0191-2917e-ISSN:1943-7692 Metrics Article History Issue Date: 15 Apr 2016Published: 25 Feb 2016First Look: 17 Nov 2015Accepted: 12 Nov 2015 Pages: 1027-1027 Information© 2016 The American Phytopathological SocietyCited byComplete genome and molecular characterization of a putative novel citrivirus from Rudbeckia sp.8 October 2022 | Virus Genes, Vol. 59, No. 1Identification of Three Viruses Infecting Mulberry Varieties19 November 2022 | Viruses, Vol. 14, No. 11Development of a multiplex RT-PCR and the occurrence characteristics of viral diseases in sweet cherry trees in the Shandong Province, ChinaPhysiological and Molecular Plant Pathology, Vol. 121Citrus leaf blotch virusCABI Compendium, Vol. CABI CompendiumComplete genome analysis of two isolates of citrus leaf blotch virus in apple in Henan province of China7 September 2021 | Tropical Plant Pathology, Vol. 46, No. 6Occurrence and molecular characteristics of citrus leaf blotch virus from citrus in China based on coat protein genes8 September 2021 | Tropical Plant Pathology, Vol. 46, No. 6Autophagy Inhibits Intercellular Transport of Citrus Leaf Blotch Virus by Targeting Viral Movement Protein30 October 2021 | Viruses, Vol. 13, No. 11Partial biological and molecular characterization of a novel citrivirus from Nandina domestica23 February 2021 | Archives of Virology, Vol. 166, No. 5A Simulation of the Use of High Throughput Sequencing as Pre-Screening Assay to Enhance the Surveillance of Citrus Viruses and Viroids in the EPPO Region27 April 2021 | Agriculture, Vol. 11, No. 5Development and application of a reverse transcription loop-mediated isothermal amplification combined with lateral flow dipstick for rapid and visual detection of Citrus leaf blotch virus in kiwifruitCrop Protection, Vol. 143Complete genome sequence of citrus yellow spot virus, a newly discovered member of the family Betaflexiviridae2 September 2020 | Archives of Virology, Vol. 165, No. 11Citrus viruses and viroidsFirst report of citrus leaf blotch virus in Satsuma mandarin in Korea1 April 2019 | Journal of Plant Pathology, Vol. 101, No. 4Distribution and molecular characterization of Citrus leaf blotch virus from Actinidia in Shaanxi province, China15 January 2019 | European Journal of Plant Pathology, Vol. 154, No. 3Prunus avium (Sweet cherry)6 June 2020Molecular characterization of a novel citrivirus from citrus using next-generation sequencing17 September 2018 | Archives of Virology, Vol. 163, No. 12Complete genome sequences of four isolates of Citrus leaf blotch virus from citrus in ChinaJournal of Integrative Agriculture, Vol. 17, No. 3First Report of Citrus leaf blotch virus in Lemon in ChinaM. J. Cao, Y.-Q. Yu, X. Tian, F. Y. Yang, R. H. Li, and C. Y. Zhou12 May 2017 | Plant Disease, Vol. 101, No. 8
Identification of a novel phylogenetic lineage of Alternaria alternata causing citrus brown spot in China.

Huang Feng,Fu Yushi,Nie Danni,Stewart Jane E,Peever Tobin L,Li Hongye

DOI: https://doi.org/10.1016/j.funbio.2014.09.006

IF: 2.91

2015-01-01

Fungal Biology

Abstract:Alternaria alternata sensu lato, casual agent of citrus brown spot, first identified in Yunnan province in 2010 and subsequently found in Zhejiang, Hunan, Guangdong provinces, Chongqing municipality andGuangxi autonomous region in China. During 2010–2012, 86 isolates were collected from diseased citrus, of which 85 % isolates were pathogenic to Ponkan tangerine. Phylogenetic analyses of Chinese and worldwide isolates using partial sequences of an endopolygalacturonase gene (endoPG) and combined dataset ofendoPG and two anonymous loci (OPA1-3, OPA2-1) found that Chinese isolates fell into two of three previously described clades. One clade (‘clade 3’) contained isolates from Turkey and Israel, and the other clade (‘clade 1’) contained isolates from Florida, USA. None of the isolates from China fell into the last previously described clade (‘clade 2’). However, 24 isolates from Hunan, Guangdong and Guangxi fell into a fourth clade (‘clade 4’) not previously reported to be associated with citrus brown spot. This clade included multilocus haplotypes known to infect Japanese pear and strawberry. The observation that Chinese brown spot isolates fell into only two of three known worldwide lineages suggests that this fungus may not have co-evolved with its host in China but elsewhere in Southeast Asia and introduced to China.
Pathotypes and Genetic Diversity of Chinese Collections of Elsinoë Fawcettii Causing Citrus Scab

Hou Xin,Huang Feng,Zhang Tian-yuan,Xu Jian-guo,Hyde D. Kevin,Li Hong-ye

DOI: https://doi.org/10.1016/s2095-3119(13)60522-5

2014-01-01

Abstract:Two scab diseases are currently recognized on citrus: citrus scab, caused by Elsinoe fawcettii, and sweet orange scab, caused by E. australis. Although these pathogens are economically important, there is no molecular data on these species in China. Here we use internal transcribed spacer sequence data to report on host-specificity and genetic relationships among 46 isolates collected from the main citrus varieties grown across China. All strains isolated were E. fawcettii. Based on pathogenicity testing on 9 different citrus species, isolates were divided into 11 pathotypes (SM, FBHR, SJCR, SPOJCR, SR, SOJG, SPOJC, SRGC, Lemon and two unnamed pathotypes). SM is a new pathotype, and two isolates did not fit into any of the known pathotypes of E. fawcettii. Inter-simple sequence repeat (ISSR-PCR) assays separated the E. fawcettii isolates into 10 subgroups; the groupings basically corresponded to the pathogenicity test.
First report of Fusarium tricinctum causing fruit rot on navel orange (Citrus sinensis (L.) Osbeck) in China

Xuezhen Yang,Yinbao Wang,Shucheng Li,Fan Wu,Zhenyu Luo,Jinyin Chen,Miaolian Xiang,Ming Chen

DOI: https://doi.org/10.1094/PDIS-04-22-0891-PDN

2022-07-08

Abstract:Citrus sinensis (L.) Osbeck is popular with consumers for its delicious taste. In December 2020, a rot symptom causing about 15% losses of a total of 450 fruits was observed on 'Newhall' navel oranges after 70 d storage (20℃, 85%-90% RH) at Jiangxi Key Laboratory for Postharvest Technology and Nondestructive Testing of Fruits & Vegetables (28.68° N, 115.85° E). The fruits were harvested from an orchard in Ganzhou City, Jiangxi Province, China (25.53° N, 114.79° E). Incipiently, the pedicles of infected fruits were brown, the peels became softened and showed yellowish-brown lesions which, gradually expanded and had white hyphae (Fig. S1A). To isolate the pathogen, the surface of diseased fruits was disinfected with NaClO (2%) for 2 min and ethanol (75%) for 0.5 min, then washed with sterile water three times. Tissues (5 × 5 mm) around the lesion were incubated on potato dextrose agar (PDA) at 28 ± 1℃ (L: D=12: 12) for 5 days. Five cultures with similar morphology were obtained and colonies initially produced white aerial hyphae and became khaki then turned pink on PDA (Fig. S1F, G, H). Abundant microconidia, macroconidia and rare chlamydospores were observed after 10 days on PDA and no glucose PDA media (Zhang et al. 2020). Macroconidia were falciform and curved to lunate, 2-4 septa, 29.38 × 3.75 µm in size (n=50) (Fig. S1K, Fig. S3). Microconidia were oval, napiform or pyriform, 0-1 septa, 12.00 × 3.43 µm in size (n=50) (Fig. S1L1 to L4, Fig. S3). Chlamydospores were found in hyphae, ellipsoidal or orbicular (Fig. S1I-1 to I-2, J-1 to J-2). The morphological features of five isolates were similar to Fusarium (Leslie and Summerell 2006). Genomic DNA of five isolates was extracted with DNA Extraction Kit (Yeasen, Shanghai, China), ITS1/ITS4, EF1Ha/EF2Tb and fRPB2-5F/fRPB2-7cR primers were used to amplify the internal transcribed spacer region (ITS), and the transcriptional elongation factor-1 alpha (TEF-1α), and RNA polymerase II (RPB2) gene sequences (White et al. 1990; Carbone and Kohn 1999; Liu et al. 1999). The ITS, TEF-1α and RPB2 sequences of five isolates were deposited in GenBank and showed 99-100% identity with corresponding sequences from F. tricinctum (Table S1). A phylogenetic tree was constructed with ITS-TEF-1α-RPB2 concatenated sequences in MEGA7.0 (Li et al. 2021) and all five isolates were placed in F. tricinctum clade with 100% bootstrap support (Fig. S2). To confirm pathogenicity, ten healthy C. sinensis fruits were surface-sterilized with 75% ethanol and inoculated with 10 µL spore suspension (1.0 × 106 spore/mL) including five wounded (with sterilized needle) and five unwounded (Fig. S1B to E). Control fruits were inoculated with 10 µL sterile water. All fruits were incubated at 28 ± 1℃, 90% RH for 7 days. The experiment was conducted three times. The lesion diameter of inoculated wounded fruits was 21.01 ± 2.52 mm and showed similar symptoms to original rotten fruits. However, the control and unwounded fruits remained healthy. To fulfill Koch's postulates, F. tricinctum was re-isolated from the inoculated fruits and deposited in Collaborative Innovation Center of Postharvest Key Technology and Quality Safety of Fruits and Vegetables in Jiangxi Province. To our knowledge, F. tricinctum has been reported on apple tree and kiwi plant in China (Zhang et al. 2021; Ma et al. 2022), but this is the first report of F. tricinctum causing fruit rot on navel orange in China. This finding provides important information for preventing postharvest disease of citrus.
Colletotrichum Species Associated with Cultivated Citrus in China

F. Huang,G. Q. Chen,X. Hou,Y. S. Fu,L. Cai,K. D. Hyde,H. Y. Li

DOI: https://doi.org/10.1007/s13225-013-0232-y

IF: 24.902

2013-01-01

Fungal Diversity

Abstract:There have been considerable advances in the understanding of species concepts in the genus Colletotrichum. This has lead to the need to carry out fresh surveys of Colletotrichum species associated with important hosts. Colletotrichum species are associated with Citrus plants as saprobes, important pre-harvest and post-harvest pathogens, as well as endophytes. In this study, a total of 312 Colletotrichum strains were isolated from leaves, shoots and fruits of cultivated Citrus and Fortunella species with or without disease symptoms across the main citrus production areas in China. The morphology of all strains were studied and multilocus (ACT, TUB2, CAL, GAPDH, GS, ITS) phylogeny established. Strains were from four important species complexes of Colletotrichum, namely C. gloeosporioides species complex, C. boninense species complex, C. acutatum species complex and a final group including C. truncatum, which was rare on Citrus species. The species belonging to the C. gloeosporioides species complex comprised C. gloeosporioides and C. fructicola, the C. boninense complex comprised C. karstii and a new species C. citricola and the C. acutatum complex included a new species, C. citri. The ability of strains to cause anthracnose on citrus fruits was tested by inoculation and strains of Colletotrichum gloeosporioides, C. fructicola and C. truncatum were pathogenic.
Serological and Molecular Detection of Citrus Tristeza Virus: A Review

Pengxiang Shang,Longfa Xu,Tong Cheng

DOI: https://doi.org/10.3390/microorganisms12081539

IF: 4.5

2024-07-27

Microorganisms

Abstract:Citrus tristeza virus (CTV) is a globally pervasive and economically significant virus that negatively impacts citrus trees, leading to substantial reductions in fruit yield. CTV occurs within the phloem of infected plants, causing a range of disease phenotypes, such as stem pitting (SP), quick decline (QD), and other detrimental diseases. Research on CTV is challenging due to the large size of its RNA genome and the diversity of CTV populations. Comparative genomic analyses have uncovered genetic diversity in multiple regions of CTV isolates' genomes, facilitating the classification of the virus into distinct genotypes. Despite these challenges, notable advancements have been made in identifying and controlling CTV strains through serological and molecular methods. The following review concentrates on the techniques of nucleic acid identification and serological analysis for various CTV isolates, assisting in the comparison and evaluation of various detection methods, which are crucial for the effective management of CTV diseases, and so contributes to the innovation and development of CTV detection methods.
Clonal Expansion in Multiple Phyllosticta Species Causing Citrus Black Spot or Similar Symptoms in China

Wen Wang,Tao Xiong,Yating Zeng,Wenwen Li,Chen Jiao,Jianping Xu,Hongye Li

DOI: https://doi.org/10.3390/jof9040449

2023-01-01

Journal of Fungi

Abstract:Phyllosticta spp. are important pathogens of citrus plants. Several Phyllosticta species associated with Citrus species grown in China have been reported; however, the relative prevalences of individual species and the distributions of their genotypes among host Citrus species remain largely unknown. In this study, we conducted an extensive survey of Phyllosticta species across 11 citrus-producing provinces in southern China. From fruits and leaves with black spots or black-spot-like symptoms, a total of 461 Phyllosticta strains were isolated. Based on molecular (ITS, actA, tef1, gapdh, LSU, and rpb2 sequences) and morphological data, the strains were systematically identified as belonging to five species: P. capitalensis, P. citrichinaensis, P. citriasiana, P. citricarpa, and P. paracitricarpa. To further understand intraspecific genetic diversity and relationships, strains of five species from different geographic and host sources were analyzed based on the multilocus sequence data. Our population genetic analyses revealed that all five Phyllosticta species on citrus showed evidence for clonal dispersals within and among geographic regions. In addition, pathogenicity tests using representative strains showed that all five species can cause disease on the tested Citrus spp. We discuss the implications of our results for the control and management of Citrus Black Spot and related diseases.

First report of Citrus tristeza virus in Citrus changshanensis cv. Huyou in Zhejiang, China

[Studies on Chemical Constituents in the Peels of Citrus Changshan-Huyou (I)].

[Isolation and Identification of Chemical Constituents from Peels of Citrus Changshan-Huyou Y.B. Chang].

A novel compound isolated from the peels of Citrus changshan-huyou Y.B.Chang

Phyllosticta Species Associated with Citrus Diseases in China

A Destructive New Disease of Citrus in China Caused by Cryptosporiopsis Citricarpa Sp. Nov.

Identification of Hop stunt viroid infecting Citrus limon in China using small RNAs deep sequencing approach

First Report and New Hosts of Pseudofabraea Citricarpa Causing Citrus Target Spot in China

Monoclonal Antibody-Based Serological Methods for Detecting Citrus Tristeza Virus in Citrus Groves

Identification of the Pathogenic Fungus Causing Brown Spot on Tangerine( Citrus Reticulata CV.Hongjv

First Report of citrus virus A infecting citrus (Citrus reticulata Blanco) in China

Complete Genome Sequence of a Novel Variant of Citrus Tristeza Virus Infecting Chinese Wild Mandarin (citrus Daoxianensis S.W. He & G.F. Liu., Syn. Citrus Reticulata Blanco) in China

First report of Neopestalotiopsis rosae causing leaf blight on Shatangju in southern China

Bayesian phylodynamic analysis reveals the evolutionary history and the dispersal patterns of citrus tristeza virus in China based on the p25 gene

First Report of Citrus Leaf Blotch Virus in Sweet Cherry.

Identification of a novel phylogenetic lineage of Alternaria alternata causing citrus brown spot in China.

Pathotypes and Genetic Diversity of Chinese Collections of Elsinoë Fawcettii Causing Citrus Scab

First report of Fusarium tricinctum causing fruit rot on navel orange (Citrus sinensis (L.) Osbeck) in China

Colletotrichum Species Associated with Cultivated Citrus in China

Serological and Molecular Detection of Citrus Tristeza Virus: A Review

Clonal Expansion in Multiple Phyllosticta Species Causing Citrus Black Spot or Similar Symptoms in China