Abstract:Visfatin, an adipokine hormone produced primarily by visceral adipose tissue in mammals, has been identified as having a crucial role in growth and development of skeletal muscle and lipids. In this research, the effects of two indel loci (35 bp indel: AC_000161.1: g. 20540–20541 Ins ACTGGAATTCTAGTTTAAAAATTGCTACTAATGAA located in intron 4; 6 bp indel: AC_000161.1: g. 25873–25878 Del: TAAAAA located in intron 5) of the visfatin gene on mRNA expression levels were studied by means of real-time quantitative PCR (qPCR) in longissimus muscle and subcutaneous fat from 95 Qinchuan cattle. Firstly, visfatin expression level in longissimus muscle of fetal cattle was prominently greater than that in calves and adult cattle (P < 0.05). The expression level of visfatin in subcutaneous fat was notably higher than that in longissimus muscle of calves and adult cattle (P < 0.05). Secondly, there were three genotypes (ins/ins, del/del and ins/del) and two genotypes (ins/del and ins/ins) detected in the 35 bp locus and 6 bp locus, respectively. Visfatin showed a minimum expression level in longissimus muscle in the homozygous deletion genotype at the 35 bp indel locus. Especially in calves, expression of visfatin was significantly greater in the heterozygous genotype than that in the homozygous insertion genotpye (P < 0.05). No statistical differences were found among visfatin expression level based on genotypes in the 6 bp indel locus (P > 0.05). Compared to heterozygous genotype, the expression level of homozygous insertion genotype was lower in longissimus muscle but greater in subcutaneous fat. These results imply that the expression levels of bovine visfatin vary with age and its indels might be putative variants mediating the expression of the bovine visfatin gene. This study provides useful information for further functional studies of bovine visfatin.

Novel 35-bp insertion in Visfatin Gene in Chinese cattle

Novel 6-Bp Deletion Mutation in Visfatin Gene and Its Associations with Birth Weight and Bodyweight in Chinese Cattle

The polymorphisms of bovine VEGF gene and their associations with growth traits in Chinese cattle

Single Nucleotide Polymorphisms of the BovineVEGF-BGene and Their Associations with Growth Traits in the Nanyang Cattle Breed

Single nucleotide polymorphisms of the bovine VEGF-B gene and their associations with growth traits in the Nanyang cattle breed (vol 23, pg 225, 2012)

Indels Within the Bovine Visfatin Gene Affect Its Mrna Expression in Longissimus Muscle and Subcutaneous Fat

Follow-up MRI Study of the Insular Cortex in First-Episode Psychosis and Chronic Schizophrenia

A Novel 28-Bp Indel Inigf1rgene Associated with Growth Traits Across Four Chinese Cattle Breeds

Novel 9-Bp Indel in Visfatin Gene and Its Associations with Chicken Growth.

Polymorphisms of the bovine WNT10B gene and their associations with growth traits

Two novel intronic polymorphisms of bovine FGF21 gene are associated with body weight at 18 months in Chinese cattle

Bovine Angptl6 Gene Effects on Growth Traits in Three Chinese Native Cattle Breeds

Novel SNPs in the bovine Transmembrane protein 18 gene, their linkage and their associations with growth traits in Nanyang cattle

A Large Indel Mutation of the Bovine ADD1/SREBP1c Gene and Its Effects on Growth Traits in Some Native Cattle Breeds from China.

Insertion/deletions within the bovine FoxO1 gene and their association analysis with growth traits in three Chinese cattle breeds

The Polymorphism of Bovine Fit Gene and Its Associations with Cattle (bos Taurus) Growth Traits

Novel SNPs of the Bovine NUCB2 Gene and Their Association with Growth Traits in Three Native Chinese Cattle Breeds

Association Analysis Between Variants in Bovine NPY Gene and Growth Traits in Nanyang Cattle (bos Tarus)

SNPs of Bovine HGF Gene and Their Association with Growth Traits in Nanyang Cattle.

Tetra-primer ARMS-PCR identifies the novel genetic variations of bovine HNF-4α gene associating with growth traits.

mRNA expression pattern and association study with growth traits of bovine vaspin gene