Molecular characterization of the cyst-forming nematode, Heterodera sinensis Chen & Zheng, 1994, from China

Jingwu Zheng,Xuqing Li,Yan Zhang,Sergei A. Subbotin

2008-01-01

Russian journal of nematology

Abstract:null

What problem does this paper attempt to address?

Molecular and Morphological Characterization of Longidorus Henanus Xu & Cheng, 1992 (nematoda: Dorylaimida) with All Four Juvenile Developmental Stages

Kai Guo,Hongli Shi,Matafeo Angelika,Jingwu Zheng

2011-01-01

Russian journal of nematology

Abstract:Two populations of Longidorus henanus Xu & Cheng, 1992 with all four developmental stages were found. Description and morphometrics of all these stages are provided. The morphological and molecular variations among intraspecies of L. henanus are discussed and given. The polytomous key codes of Chen et al. (1997) for L. henanus are modified in parentheses as follows: A34, B23, C34, D2, E3, F(2)3, G(1)23, H12, I1. Furthermore, the phylogenetic trees of 18S rRNA gene and D2-D3 expansion region of 28S rRNA gene supported L. henanus as a unique and valid species with respect to previously sequenced Longidorus species.
Morphological and molecular characterization of cyst-forming nematodes on wheat from Shanxi Province

LIU Kun,XI Tian-yuan,ZHANG Yao-fang,ZHENG Jing-wu

DOI: https://doi.org/10.3785/j.issn.1008-9209.2011.11.081

2012-01-01

Abstract:Cyst-forming nematode parasitizing on wheat is a serious problem in the world.The first report of cyst nematode infecting wheat in China was in 1989,and since then the nematodes were reported in 13provinces of China.In Shanxi Province no systematic survey were made for the distribution and species identification of the cyst-forming nematodes parasitizing in wheat.During 2010to 2011,an extensive survey and investigation on cyst-forming nematodes parasitizing wheat in Shanxi Province was carried out.Key morphological characteristics and morphometrics of cysts and second-stage juveniles of major populations were systematically observed and measured,and molecular data of rDNA-ITS region of the populations were analyzed.The cysts were characterized by lemon-shaped,with posterior protuberance,vulval silt short,bifenestrate,bullae present and under bridge absent.Morphometric comparison of cysts and second stage juveniles showed that all the cyst-forming nematode populations from Shanxi were Heterodera avenae.The phylogenic analysis of the rDNA-ITS sequences based on nine cereal cyst nematode(CCN) populations from Shanxi Province showed a close genetic relationship with the H.avenae populations from China including Anhui,Jiangsu,Henan,Beijing,Hebei and Qinghai,and India,and H.australis population from Australia,however,the CCN populations from China had a distant genetic relationship with H.avenae from European countries including Germany,Morocco,Spain,United Kingdom and France.Amplification of rDNA-ITS region of H.avenae populations collected from Shanxi yielded a fragment with the length of 1 045bp.Both morphological and molecular identification of cyst-forming nematode populations parasitizing on wheat in Shanxi confirm that all the populations collected in this study are H.avenae,and no other species are detected.
Morphological and Molecular Characterization of Hemicycliophora Subbotini N. Sp. (tylenchida: Hemicycliophoridae) from China.

Munawar Maria,Ruihang Cai,Nan Qu,Pablo Castillo,Jingwu Zheng

DOI: https://doi.org/10.11646/zootaxa.4433.1.10

IF: 0.9

2018-01-01

Zootaxa

Abstract:Sheath nematodes of the genus Hemicycliophora are migratory root-ectoparasites of many crops, but the damage is documented for only a few species. Hemicycliophora subbotini n. sp., isolated in Hangzhou, Zhejiang, China, from the rhizosphere of camphor tree (Cinnamomum camphora (L.) Presl), is described and characterized morphologically and molecularly with important morphological details elucidated by SEM studies. The new species can be characterized by the conoid lip region, with bulging oral disc protruding beyond the first annulus in some specimens. Oral disc narrow ovate, amphidial apertures covered by lateral plates, lying in the same plane as oral disc when observed en face. Stylet 118 (108-125) μm long and flexible, stylet knobs concave shaped having a slight cavity. The excretory pore is located 1-2 annuli posterior to the base of pharyngeal bulb. Vulval lips slightly modified with small vulval sleeve, spermatheca rounded to oblong. Anus located 18 (15-22) annuli posterior to vulva. Tail elongated, with conoid or slightly offset spike having a narrowly rounded terminus. The study provides the first description of a new Hemicycliophora species from China. Phylogenetic analyses based on D2-D3 expansion segments of the 28S and ITS fragments revealed the new species forming a separate clade from other Hemicycliophora species which supported the status as a new species of this genus.
Morphological and Molecular Characterisation of Hemicriconemoides Paracamelliae Sp N. (nematoda: Criconematidae) and Two Known Species of Hemicriconemoides from China

Munawar Maria,Ruihang Cai,Pablo Castillo,Jingwu Zheng

DOI: https://doi.org/10.1163/15685411-00003147

2018-01-01

Nematology

Abstract:Summary Sheathoid nematodes of the genus Hemicriconemoides are migratory root-ectoparasites of many crops but damage is documented for only a few species. Hemicriconemoides paracamelliae sp. n., isolated in Hangzhou, Zhejiang, China, from the rhizosphere of Cinninghamia lanceolata, is described together with H. kanayaensis and H. parataiwanensis. These three species are characterised morphologically and molecularly with important morphological details elucidated by SEM photographs. The new species can be characterised by the en face view having a dorsoventrally orientated oral disc with slit-like opening, and the labial plate being composed of two lateral semi-globular shaped projections on the lateral sides of the oral disc. This new species has the first lip annulus expanded and slightly wider than the second, stylet 83 (80-85) μm long, excretory pore located 5-6 annuli posterior to the base of the pharyngeal bulb, vulva slit-like, vulval flaps absent, spermatheca rounded to oblong-shaped, and anus located 5-8 annuli posterior to vulva. The tail is elongated, conoid, with the terminal annuli curving dorsally or ventrally to form a finely rounded tip. The study provides the first record of H. kanayaensis from mainland China, a new host association of H. parataiwanensis, and molecular sequencing data of the 18S, 28S D2-D3 and ITS sequences.
Heterodera koreana,a new record of cyst-forming nematodes in Zhejiang Province,China

Hongxue ZHU,Zhongling TIAN,Ruihang CAI,Xiaolin LI,Jingwu ZHENG

DOI: https://doi.org/10.3785/j.issn.1008-9209.2016.10.071

2017-01-01

Abstract:Cyst-forming nematode is an important plant parasitic nematode group,in which over 80 species were reported and described.There are many economically important cyst-forming nematodes species in China,such as Heterodera glycines,Heterodera avenae,and Heterodera filipjevii.During 2015—2016,a survey for cyst-forming nematodes in Zhejiang,eastern China,revealed the distribution of a cyst-forming nematode population from Phyllostachys praecox in Lin'an,Zhejiang,eastern China.Morphological characteristics and morphometrics of cysts and second-stage juveniles (J2s)were observed and measured using light microscope and scanning electron microscope.Cysts were characterized by appearing light to dark brown in coloration,globose to subspherical shape of body contour,distinct neck and cone,lacking underbridge,bullae and fenestrae,body length ranging from 575.0 to 1230.0μm,body width ranging from 397.0 to 872.0μm,and vulva slit length ranging from 36.7 to 50.9μm.J2 was characterized by hemispherical labial region,nearly continuous with round body contour and stylet knobs,three incisures in lateral field,tail tapering and tail hyaline region accounting for 55% 75%,body length ranging from 426.3 to 608.0μm;body width ranging from 15.9 to 29.3μm;stylet length ranging from 17.7 to 21.9μm;dorsal gland orifice ranging from 4.3 to 6.2μm;tail length ranging from 68.7 to 84.5μm.Amplification of the ITS and D2/D3 fragments of the cyst-forming nematodes from bamboo with universal primers AB28 (ATATGCTTAAGTTCAGCGGGT)and TW81 (GTTTCCGTAGGTGAACCTGC),D2 A (ACAAGTACCGTGA GGGAAAGTTG)and D3B (TCGGAAGGAACCAGCTACTA)yielded PCR fragments with sizes of 1006 bp (GenBank:KX640828)and 786 bp (GenBank:KX640827),respectively,the sequences of ITS and D2/D3 of cyst nematodes parasitizing on bamboo were 99.7% and 99.6% similar to that of Heterodera koreana deposited in GenBank,respectively.Combined with morphological, morphometrics and molecular phylogeny analysis, the results showed that the cyst nematodes parasitizing on bamboo from Lin'an,Zhejiang,China is H.koreana,is a new record in Zhej iang,Eastern China.
A New Rare Nematode Nothocriconemoides Hangzhouensis N. Sp. (nematoda: Criconematidae) from Hangzhou, China

Munawar Maria,Wentao Miao,Ruihang Cai,Pablo Castillo,Jingwu Zheng

DOI: https://doi.org/10.21307/jofnem-2020-006

2020-01-01

Journal of Nematology

Abstract:The Family Criconematidae is commonly referred as ring nematodes that include some members with economic importance as plant parasites. During a recent nematode inventory survey at Zhejiang Province, China, a new species of genus Nothocriconemoides was detected in the rhizosphere of elm tree. Nothocriconemoides hangzhouensis n. sp. can be characterized by the female body having annuli with fine longitudinal striations and 2 to 3 anastomoses at the posterior half of the body. The first cephalic annulus is rounded and expanded enclosing the lip region, and the second annulus is narrow, offset, collar like. En face view shows a central elevated labial disk bearing four distinct equal-sized submedian lobes and "I" shaped oral aperture. Excretory pore is located 3-4 annuli posterior to esophageal bulb. Vagina is straight and vulva closed. The ventral side of postvulval annuli is inverted, in majority of individuals. Anus is indistinct and located on the next annuli posterior to vulva. Tail is short, conoid, with forked or branched terminus. Juveniles are devoid of collar-shaped annuli in the lip region. The cephalic region has two rounded annuli where the first annulus shows slight depression in the middle. Body annuli are finely crenated. Anus is indistinct and located 3 to 4 annuli from tail terminus. Tail is short ending in a single lobed terminus. Phylogenetic studies based on analysis of the D2-D3 expansion segments of the 28 S rRNA, ITS rRNA, partial 18 S rRNA, and coxI gene revealed that the new species formed a separate clade from other criconematid species, thereby supporting its status as a new species of the genus. The new species showed close relationships with Discocriconemella sinensis. Additionally, this is the first record of genus Nothocriconemoides from China.
Morphological identification and description of three rice root nematodes occurring in China

Mei YuanYuan,Guo Kai,Zheng JingWu

2009-01-01

Abstract:According to the morphological characters and morphometrics,three species in genus Hirschmanniella were identified.They were H.oryzae,H.mucronata and H.gracilis.Some morphometrics of H.oryzae and H.mucronata varied slightly from the original descriptions of type specimens,most of other morphometric data were within the reference value range.Compared to the original descriptions of type specimen,the data of H.gracilis were smaller.This was the first report of H.gracilis in Zhejiang Province,eastern China.
Morphological and Molecular Characterization of Geocenamus Persici N. Sp. (nematoda: Merliniinae) from China.

Chenying Zhang,Maria Munawar,Pablo Castillo,Shaojie Han,Jingwu Zheng

DOI: https://doi.org/10.11646/zootaxa.5100.4.8

IF: 0.9

2022-01-01

Zootaxa

Abstract:A new stunt nematode species, Geocenamus persici n. sp. was recovered from the rhizosphere of peach (Prunus persica) in Zhejiang Province, China. This species is characterized by a dome-shaped labial region with six bulging sectors. The lip region is slightly offset from the rest of the body with five annuli; cuticle with over 30 longitudinal striae; stylet slender, 19 to 21 m long; excretory pore at the anterior region of the basal pharyngeal bulb; tail cylindrical, 55 to 79 m long with striated terminus. Males are common. Morphologically, the species is close to G. brevicaudatus, G. chengi, G. conicaudatus, G. quadrifer, G. rugosus, and G. tartuensis. Phylogenetic relationships of the new species placed G. persici n. sp. with other species of subfamily Merliniinae. However, it has a sister relationship with G. chengi. Since the new species is found in the peach plantations, our study will lay a foundation to initiate investigations on the occurrence of stunt nematodes in peach growing areas and will aid the researchers to determine whether this group of nematodes cause peach plantation diseases.
Description of Longidorus cheni sp. n. (Nematoda, Longidoridae) from China.

Eda Marie Barsalote,Hoa Thi Pham,Stela Lazarova,Vlada Peneva,Jingwu Zheng

DOI: https://doi.org/10.3897/zookeys.744.23265

IF: 1.496

2018-01-01

ZooKeys

Abstract:Longidorus cheni sp. n., an amphimictic species recovered from the rhizosphere of Larix principis-rupprechtii and Pyracantha fortuneana in Shanxi and Beijing, China, is described and illustrated. The taxonomic position of L. cheni sp. n. among other species within the genus was elucidated using morphometric and molecular data, and phylogenetic relationships were inferred using D2-D3 expansion domains of 28S and 18S rRNA genes by Bayesian Inference (BI) method. The new species is characterised by females with a medium body size (L = 4.9-6.6 mm), a lip region slightly expanded, broadly rounded frontally and laterally, the amphidial fovea broad and symmetrically bilobed at base, odontostyle long and slender (143-168 mu m), odonthophore slightly swollen at the base, tail short bluntly conoid to rounded. Guide ring located far posterior from the oral aperture (70-93 mu m). Males with two ad-cloacal pairs of supplements preceded by a row of 10-14 ventromedian supplements, with robust spicules measuring 111-126 mu m along the median line. Three juvenile stages were present, tail shape of J1 elongate conoid while in J2 and J3 the tail gradually becomes bluntly rounded. Codes for identifying the new species are: A6-B3-C5-D2-E2-F3-G1-H1-I2-J2-K2. Longidorus cheni sp. n. belongs to a group of species with a guide ring at the midodontostyle position that have a predominantly Asiatic origin. It differs from all of them by a combination of morphological characters and unique sequences of partial 18S and D2-D3 region of 28S rRNA genes. The percentage dissimilarities in partial 18S and D2-D3 28S rRNA genes of L. cheni to the closest species (L. litchii, L. fangi, L. jonesi and L. juglans) were 1.5 %-1.8 % and 16.8-18.3 %, respectively.
Characterisation of Two Chinese Native Hemicriconemoides Species (nematoda: Criconematidae) with Updated Descriptions of H-chitwoodi Esser, 1960 and Criconemoides Myungsugae Choi & Geraert, 1975

Munawar Maria,Ruihang Cai,Pablo Castillo,Carolina Cantalapiedra-Navarrete,Jingwu Zheng

DOI: https://doi.org/10.1163/15685411-00003206

2019-01-01

Nematology

Abstract:SummaryPopulations ofHemicriconemoides chitwoodi,H. fujianensis,H. parasinensis, andCriconemoides myungsugaeisolated in China from the rhizosphere soil of woody perennials were characterised molecularly, important morphological details being elucidated by SEM observations. The morphometric data of the Chinese populations were compared with all previously reported populations. The SEM observations ofen faceviews indicated thatH. chitwoodiandH. parasinensishave lip patterns belonging to type 1 and phylogenetically both species clustered with otherHemicriconemoidesspecies that showed the same kind of lip pattern. On the other hand,H. fujianensisshowed a lip pattern belonging to type 2 and phylogenetically appears basal to the above-mentioned clade. SEM observation ofC. myungsugaeshowed that the first lip annulus forms a non-projecting uninterrupted disc and the labial annulus is a rectangular shape with slight dorsal and ventral indentations. Phylogenetic relationships amongCriconemoidesspp. are apparently not well resolved. The present study provides updated morphological descriptions, molecular diagnostics and phylogenetic relationships ofH. chitwoodi,H. fujianensis,H. parasinensis, andC. myungsugae, the last species being the first report from China.
Molecular and Biological Characterization of Neoseiulus Species from China

Jiale Lv,Fengqi Li,Chunyan Wu,Jin Zhang,Guirong Wang,Endong Wang,Xuenong Xu

DOI: https://doi.org/10.11158/saa.21.3.10

2016-01-01

Systematic and Applied Acarology

Abstract:In a survey conducted in southern China for potential biocontrol agents of spider mites, a Neoseiulus sp. was recorded and identified as Neoseiulus californicus based on morphological diagnosis, although 3 morphological features specific for this population were observed. To verify the taxonomic status of this population, we compared DNA sequences from three molecular markers-12S rRNA, Cyt b mtDNA and ITS-with those of other N. californicus populations from multiple countries, using N. idaeus as outgroup. All 3 molecular markers were congruent and supported the Chinese Neoseiulus specimens to be N. californicus. The intraspecific genetic distances determined from all populations including the Chinese one were 0.75, 1.8, and 0.049 while the interspecific genetic distances were 12.1, 28.2, and 3.9 for 12S rRNA, Cyt b mtDNA, and ITS, respectively. In addition, comparison of biological data-development, reproduction and life table parameters-of different N. californicus populations based on published data also supported both molecular and morphological diagnosis of the Chinese Neoseiulus specimens. The Chinese population had the second shortest developmental duration when fed with Tetranychus urticae, and moderate fecundity and life table parameters when compared to other populations.
Morpho-Molecular and Ultrastructural Characterization of <i>Discocriconemella parasinensis</i> n. sp. from Zhejiang Province, China

Junxia Li,Maria Munawar,Pablo Castillo,Jingwu Zheng

DOI: https://doi.org/10.2478/jofnem-2022-0011

2022-01-01

Journal of Nematology

Abstract:During a recent inventory survey of the nematofauna of tea plantation at Zhejiang Province, China, Discocriconemella parasinensis n. sp. was detected in the rhizosphere of Camellia sinensis. The new species can be characterized by having the uninterrupted rounded labial disc, en face view showing rectangular-rounded labial plate without submedian lobes, R = 82.6 (80-86), Rex = 22 (21-23), stylet length of 68.3 (59-76) mu m, excretory pore located 1-2 annuli posterior to the esophageal bulb, vulva open, postvulval body elongated conoid, and tail conoid with bilobed terminus. Morphologically, the species shares the same lip-type with D. discolabia, D. mauritiensis, D. mineira, D. perseae, and D. sinensis. Phylogenetic relationships of the new species based on D2-D3 expansion segments of 28S, ITS, and 18S rRNA genes revealed that D. parasinensis n. sp. formed a separated Glade from other criconematid species, thereby supporting its status as a new species of the genus. The new species showed close phylogenetic relationships with Criconemoides geraerti.
Morphological and Molecular Characterization of the Rice Root-Knot Nematode, Meloidogyne Graminicola, Golden and Birchfeild, 1965 Occurring in Zhejiang, China

Tian Zhong-ling,Munawar Maria,Eda Marie Barsalote,Pablo Castillo,Zheng Jing-wu

DOI: https://doi.org/10.1016/s2095-3119(18)61971-9

2018-01-01

Abstract:The rice root-knot nematode Meloidogyne graminicola is a severe pest of rice. In China, it was first reported from Hainan Province, and later from several other provinces. In the present study, a rice root-knot nematode population found from the rice cultivation areas of Zhejiang Province, China is characterized via molecular analysis using internal transcribed spacer (ITS) and cytochrome c oxidase subunit II (coxII)-16S rRNA genes and scanning electron microscopy (SEM) observations of males and the second-stage juveniles. Morphometric data and molecular sequence comparisons for all M. graminicola populations occurring in China are also provided. The overall morphology of M. graminicola found in Zhejiang match well with the original description, though males have a slightly longer body and stylet, and a shorter tail, while the second-stage juvenile is also slightly longer than in the original description. This is the first report of M. graminicola from Zhejiang. Phylogenetic studies based on coxII suggest that all the Chinese populations belong to Type B. This study expands knowledge of the increasing distribution and phylogenetic relationships of M. graminicola that occur in China.
Molecular Characterisation of Chinese Heterodera Glycines and H-Avenae Populations Based on Rflps and Sequences of Rdna-Its Regions

JW Zheng,SA Subbotin,L Waeyenberge,M Moens

2000-01-01

Russian journal of nematology

Abstract:Restriction profiles and sequences of the ITS region of Chinese populations of Heterodera glycines and H. avenae are given. In H. glycines, heterogeneity was detected after restriction of the PCR product with AvaI. This is the principal identification enzyme for this species, and usually yields four fragments of 552, 478, 367 and 112 bp. Restriction of the PCR product from the Chinese H. avenae population by HinfI and True9I produced RFLP profiles that differentiated it from other cereal cyst nematode populations.
Description and Distribution of Three Criconematid Nematodes from Hangzhou, Zhejiang Province, China.

Maria Munawar,Powers O. Thomas,Tian Zhongling,Harris Timothy,Higgins Rebecca,Zheng Jingwu

DOI: https://doi.org/10.21307/jofnem-2018-010

2018-01-01

Journal of Nematology

Abstract:Populations of Criconemoides parvus , Discocriconemella hengsungica , and Discocriconemella limitanea , isolated in Hangzhou, China from the rhizosphere soil of woody perennials were characterized morphologically and molecularly. The morphometric data of the Chinese populations were compared with populations from other regions of the world. DNA barcoding with the mitochondrial COI gene confirmed conspecificity of Chinese and Costa Rican populations of D. limitanea . Phylogenetic assessment using a near full-length 18S ribosomal DNA sequence provided weak support for a grouping of Criconemoides parvus from China and C. annulatus from western North America. The phylogenetic position of D. hengsungica from China and an unknown species of Discocriconemella from Thailand relative to D. limitanea suggests that the genus Discocriconemella is not monophyletic. The study provides the first record of D. hengsungica in China and confirms the presence of C. parvus previously reported from China. Biogeographic implications of these nematode distributions are discussed.
Cactodera xinanensis n. sp. (Nematoda: Heteroderinae), a new species of cyst-forming nematode from Southwest China, with a key to the Genus Cactodera

C.-H. Ni,Q.-Y. Li,Z.-F. Yang,C.-L. Xu,H. Xie

DOI: https://doi.org/10.1017/s0022149x24000415

2024-11-13

Journal of Helminthology

Abstract:The cyst nematodes, subfamily Heteroderinae, are plant pathogens of worldwide economic significance. A new cyst nematode of the genus Cactodera within the Heteroderinae, Cactodera xinanensis n. sp., was isolated from rhizospheres of crops in the Guizhou and Sichuan provinces of southwest China. The new species was characterized by having the cyst with a length/width = 1.3 ± 0.1 (1.1–1.6), a fenestral diameter of 28.1 ± 4.3 (21.3–38.7) μm, vulval denticles present; second-stage juvenile with stylet 21.5 ± 0.5 (20.3–22.6) μm long, tail 59.4 ± 2.0 (55.9–63.8) μm long and hyaline region 28.7 ± 2.7 (25.0–36.3) μm long, lateral field with four incisures; the eggshell with punctations. The new species can be differentiated from other species of Cactodera by a longer tail and hyaline region of second-stage juveniles. Phylogenetic relationships within populations and species of Cactodera are given based on the analysis of the internal transcribed spacer (ITS-rRNA), the large subunit of the nuclear ribosomal RNA (28S-rRNA) D2-D3 region and the partial cytochrome oxidase subunit I (COI) gene sequences here. The ITS-rRNA, 28S-rRNA and COI gene sequences clearly differentiated Cactodera xinanensis n. sp. from other species of Cactodera. A key and a morphological identification characteristic table for the species of Cactodera are included in the study.

zoology,parasitology
Morphological and Molecular Characterization of the Rice Root Nematode, Hirschmanniella Mucronata, from Jiangsu, China

Hui FENG,Li-hui WEI,Huai-gu CHEN,Yi-jun ZHOU

DOI: https://doi.org/10.13926/j.cnki.apps.2016.04.006

2016-01-01

Abstract:Rice root nematode Hirschmanniella spp.spreads globally and has been found in many provinces regions of China.However,less report has recorded this kind of threatening nematode in Jiangsu province of China.In the present study,we isolated numerous Hirschmanniella spp.from the rice roots in the paddy field,located in Nanjing,Jiangsu province.Based on the external morphology and morphometrics,we determined that Hirschmanniella mucronata was the dominant species in all nematode population from the infected root tissues.Although some morphometrics of H.mucronata varied from the descriptions of other known isolates and the type specimens,most of morphometric data were within the reference value range.The newly identified H.mucronata was highly similar with the isolates from Taiwan and Belgium,based on the ITS-rRNA sequences and the nucleotide variation in ITS,5.8S rRNA and ITS2.The results of the phylogenetic analysis based on the sequences of the D2-D3 expansion regions of the 28S,partial 18S rRNA and ITS1-rRNA genes,revealed three concordant clades in the genus Hirschmanniella,thus these molecular makers provide accurate species identification and assessing phylogenetic relationships within Hirschmanniella genus.
Morphological and Molecular Identification of Cereal Cyst Nematodes on Wheat from Jiangsu Province of China

WANG Xuan,LE Xiu-hu,SONG Zhi-qiang,XIANG Gui-lin,LIN Yu,LI Hong-mei

DOI: https://doi.org/10.3864/j.issn.0578-1752.2013.05.008

2013-01-01

Abstract:【Objective】The objective of this study is to understand the species of cereal cyst nematodes(CCN) from Jiangsu Province and their genetic relationships,and to provide valuable information for screening resistant wheat cultivars,plant breeding and integrated control of the disease.【Method】The morphology and morphometrics for cyst,vulval cone and second stage juvenile were characterized for 13 typical Jiangsu populations.The ITS regions of ribosomal DNA were amplified and the PCR products were sequenced.A phylogenetic tree was constructed based on the ITS sequences.【Result】The results demonstrated that 13 Jiangsu populations were similar with those described populations of Heterodera avenae by comparing the morphological characters and morphometric data.The phylogenetic tree revealed that the Jiangsu populations were grouped with domestic and abroad populations of H.avenae into a big branch,which could clearly separate Chinese populations from foreign populations.【Conclusion】All the studied CCN populations from Jiangsu Province were identified as H.avenae.The variations in morphological characters and ITS sequences among different Jiangsu populations were very small.The status of H.filipjevi in Jiangsu Province is unknown.
IDENTIFICATION AND PHYLOGENETIC ANALYSIS OF NINE CYST NEMATODE POPULATIONS FROM MAIN FIELD CROPS IN CHINA

Y. X. Feng,D. Wang,Y. H. Xuan,L. J. Chen,Y. Y. Wang,X. Y. Liu,Y. Chen,X. P. Lu,X. F. Zhu,Y. X. Duan

2018-01-01

Abstract:Cyst-forming nematodes, a major category of plant parasitic nematodes, cause severe yield losses in many crop plants and are a serious threat to food production in China. However, the reports focused on identification of species abundance and distribution of cyst nematodes on mam crops in China are fewer. During 2012-2014, nine populations of cyst nematodes collected from various locations in major crop cultivation areas of China were identified as four species (Heterodera glycines, H. avenae, H. filipjevi, H. elachista) based on morphology and molecular analysis H. filipjevi and H. elachista were first discovered in Anhui and Jiangxi Provinces, respectively In addition, a PCR-ITS-RFLP method was applied to distinguish all the studied populations, which revealed molecular characteristics of cyst nematode species on major field crops in China. The present study broadens the knowledge regarding distributions and molecular features of vital Heterodera species and populations, and will also provide useful information for early protection of cystnematodes in China.
Heterorhabditidoides Chongmingensis Gen. Nov., Sp. Nov. (rhabditida: Rhabditidae), a Novel Member of the Entomopathogenic Nematodes

Chongxing Zhang,Jingrui Liu,Mingxu Xu,Jie Sun,Shouyun Yang,Xianhui An,Guofu Gao,Maosong Lin,Ren Lai,Ziyi He,Yidong Wu,Keyun Zhang

DOI: https://doi.org/10.1016/j.jip.2008.02.011

IF: 2.795

2008-01-01

Journal of Invertebrate Pathology

Abstract:During a recent soil sample survey in Eastern China, a new entomopathogenic nematode species, collected from the Chongming Islands in the southern–eastern area of Shanghai, was discovered. Morphological characteristics of different developmental stages of the nematode combined with molecular data showed that this nematode is a new genus of Rhabditidae, and described as Heterorhabditidoides chongmingensis gen. nov., sp. nov., for that it shares more morphological characteristics with heterorhabditids than with steinernematids. For males, the papillae formula of bursa is 1, 2, 3, 3, with constant papillae number in the terminal group, stoma tubular-shaped and about 1.5 head width; cheilorhabdions cuticularized, esophageal collar present and long, median bulb present. For infective juveniles, EP=90 (80–105)μm, ES=104 (92–120)μm, tail length=111 (89–159)μm, and a=19.1 (15–21). The percentages of the nucleotides A, T, C and G in the ITS1 regions of the new species are significantly different from those of heterorhabditids and other rhabditids. Molecular phylogenetic trees based on 18S rDNA and the internal transcribed spacer (ITS) sequences data revealed that the new entomopathogenic nematode species forms a monophyletic group, which is a sister group of the clade comprised of some genera of Rhabditidae.

Molecular characterization of the cyst-forming nematode, Heterodera sinensis Chen & Zheng, 1994, from China

Molecular and Morphological Characterization of Longidorus Henanus Xu & Cheng, 1992 (nematoda: Dorylaimida) with All Four Juvenile Developmental Stages

Morphological and molecular characterization of cyst-forming nematodes on wheat from Shanxi Province

Morphological and Molecular Characterization of Hemicycliophora Subbotini N. Sp. (tylenchida: Hemicycliophoridae) from China.

Morphological and Molecular Characterisation of Hemicriconemoides Paracamelliae Sp N. (nematoda: Criconematidae) and Two Known Species of Hemicriconemoides from China

Heterodera koreana,a new record of cyst-forming nematodes in Zhejiang Province,China

A New Rare Nematode Nothocriconemoides Hangzhouensis N. Sp. (nematoda: Criconematidae) from Hangzhou, China

Morphological identification and description of three rice root nematodes occurring in China

Morphological and Molecular Characterization of Geocenamus Persici N. Sp. (nematoda: Merliniinae) from China.

Description of Longidorus cheni sp. n. (Nematoda, Longidoridae) from China.

Characterisation of Two Chinese Native Hemicriconemoides Species (nematoda: Criconematidae) with Updated Descriptions of H-chitwoodi Esser, 1960 and Criconemoides Myungsugae Choi & Geraert, 1975

Molecular and Biological Characterization of Neoseiulus Species from China

Morpho-Molecular and Ultrastructural Characterization of <i>Discocriconemella parasinensis</i> n. sp. from Zhejiang Province, China

Morphological and Molecular Characterization of the Rice Root-Knot Nematode, Meloidogyne Graminicola, Golden and Birchfeild, 1965 Occurring in Zhejiang, China

Molecular Characterisation of Chinese Heterodera Glycines and H-Avenae Populations Based on Rflps and Sequences of Rdna-Its Regions

Description and Distribution of Three Criconematid Nematodes from Hangzhou, Zhejiang Province, China.

Cactodera xinanensis n. sp. (Nematoda: Heteroderinae), a new species of cyst-forming nematode from Southwest China, with a key to the Genus Cactodera

Morphological and Molecular Characterization of the Rice Root Nematode, Hirschmanniella Mucronata, from Jiangsu, China

Morphological and Molecular Identification of Cereal Cyst Nematodes on Wheat from Jiangsu Province of China

IDENTIFICATION AND PHYLOGENETIC ANALYSIS OF NINE CYST NEMATODE POPULATIONS FROM MAIN FIELD CROPS IN CHINA

Heterorhabditidoides Chongmingensis Gen. Nov., Sp. Nov. (rhabditida: Rhabditidae), a Novel Member of the Entomopathogenic Nematodes