Cloning and Sequence Analysis of the Inner Mongolia Cashmere Goat Keratin 5 Gene Promoter
Ba-la WUDU,Ru-han A,Jiang-hong WU,Yan-jun ZHANG,Wen-guang ZHANG,Jin-quan LI
DOI: https://doi.org/10.3969/j.issn.1671-7236.2012.06.003
2012-01-01
Abstract:This experiment was conducted to study the potential regulatory sequence of Keratin 5(K5).This study according to the UCSC bovine K5gene 5′flank regions designed the PCR primers,and Inner Mongolia Cashmere goat K5gene promoter was amplified.Analysis the K5gene promoter sequence after product purification,ligation,transformation and sequence.It was found that 1452bp Inner Mongolia Cashmere goat K5promoter sequence was confirmed,which showed 91.5%and 74% homology with that of bovine and human respectively.The transcription start site was mapped to-101bp of translation initiation site and two TATA boxes located in-129to-124bp(ATAAAA)and-178to-174bp(TTAAT)of translation initiation site respectively.The potential transcription factor binding motifs were predicted after analysis of promoter online software,including(5′to 3′)SRY,MZF1,v-Myb,SRY,AP-1,CDP CR,HNF-4,AML-1a,HSF2,AP-4,AP2,AP2,Sp1,Nkx-2,Sp1and GATA-1,in which SRY(TGTGTTT)and CDP CR(GATTGATGGC)were specific for Cashmere goat,and HNF-4,AML-1a,HSF2,AP-4,AP2,Sp1,Nkx-2and GATA-1(AGCCATCATG)were conserved in Cashmere goat,bovine and human.Moreover,the two minimal enhancer reside from-140to-91bp and-114to-67bp of translation initiation site respectively,and contained 24bp(GCGGCTCCCAGGTAACAGAGCCGC)overlap,which might be related with the Cashmere goat K5gene transcriptional regulation.In this experiment,we inferred the transcription start site,transcription factor binding motifs and minimal enhancer elements in Inner Mongolia Cashmere goat K5gene promoter,which may be helpful for exploring the mechanism of gene expression of cashmere goat K 5gene