Cloning of Rat β-defensin-2 cDNA and Its Inducible Expression in the Skin

Xinnian Chen,Ning Huang,Qi Wu,BoYao Wang
2000-01-01
Abstract:Total RNA was isolated from rat skin. The cDNA fragment was obtained by RT-PCR amplification with primers (P 1 5′ → 3′TTCAGTCATGAGGATCCATTAC & P 2 5′ → 3′ GGTTCTTGGTCTTTTTATCTAC). Based on the nucleic acid sequence analysis and the deduced amino acid sequence, the cDNA encoded peptide sequence was found to be homologous to human β-defensin hBD-2 (50% identity and 32% similarity in mature peptide), and it possessed six characteristic cysteines. Thus, we named it rat β-defensin-2 (rBD-2). This study also showed that the expression of rat β-defensin-2 mRNA markedly increased in rat skin challenged with E. coli ML-35p, a phenomenon similar to human β-defensin-2 gene expression in the skin. It is suggested that β-defensin-2 might be an important immune mediator in the skin defense, response to infections.
What problem does this paper attempt to address?