A simple and efficient method of DNA extraction from formalin-fixed and paraffin-embedded tissues for screening EGFR gene mutation by gene sequencing.
Dan Zhang,Zhenqiang Cao,Guizhen Zhang,Mei Wu,Yucheng Zhang,Zhenwu Du,Xuewen Zhang
DOI: https://doi.org/10.3760/cma.j.issn.0366-6999.20140130
IF: 6.133
2014-01-01
Chinese Medical Journal
Abstract:Epidermal growth factor receptor (EGFR) is frequently overexpressed in non-small-cell lung cancer (NSCLC) and plays a key role in tumorigenesis.1 Small molecule tyrosine kinase inhibitors (TKIs), such as gefitinib, erlotinib, and icotinib, which can inhibit receptor tyrosine kinase activity of EGFR become clinically available for the treatment of non-small-cell lung cancer (NSCLC).2 NSCLC patients with EGFR mutation have experienced a marked response to EGFR-TKIs therapy.3 Detection of mutations of the EGFR gene is critical for predicting the response to therapy with TKIs.4 Now, the DNA for screening EGFR gene mutation has been commonly extracted from formalin-fixed and paraffin-embedded (FFPE) tissues of NSCLC patients. The quantity and quality of the extracted DNA from FFPE remains a challenge for screening EGFR gene mutation. In our previous studies, we have described a simple and effective protocol of DNA extraction from FFPE specimens of NSCLC patients using Triton X-100, which provided high-quality DNA for amplification of EGFR gene by polymerase chain reaction (PCR).5 Here, we will further explore whether extracting DNA from FFPE by this method can be a way for EGFR mutation detection with DNA sequencing. METHODS FFPE tissue samples FFPE NSCLC blocks were obtained from seven patients, and tissue samples were achieved in 2013 at the Pathology Department of the China-Japan Union Hospital of Jilin University. From each block, 10-μm sections were cut on a standard microtome (Leica-Microsystems). Three to four sections of paraffin-embedded tissues were placed individually in a 1.5-ml microcentrifuge tube. These sections were dewaxed with xylene, and washed with 100% ethanol to remove xylene completely, and then stored at 4°C until DNA extraction. During clinical test, DNA was extracted from FFPE tissues via EZgene™ FFPE DNA miniprep commercial kit (Biomiga, CA, USA) according to the standard protocol recommended by the kit. Types of mutations of EGFR exon 21 in these samples were detected by gene sequencing. DNA extraction from FFPE tissues using Triton X-100 This method of DNA extraction from FFPE tissues was according to the study.3 Chiefly, Triton X-100 buffer was prepared, including 10 mmol/L Tris-HC1 (pH 10.0) and 1% Triton X-100 (Sigma, USA). Twenty-one tubes containing dewaxed FFPE tissues were tested by adding 40 μl Triton X-100 buffer into these tubes; each of the three tubes were tested as different sample. Three tubes were heated at 95°C for 30 minutes with a heat block (Bioer, China), followed by centrifugation at 13 000 r/min for 5 minutes. DNA was located in the supernatant. Evaluation of DNA yields The extracted DNA from FFPE tissues was observed by electrophoresis on 2% agarose gels with ethidium bromide dye. The amount of DNA product was measured according to the standard protocol recommended by the manufacturer using a photometer (BIOTEK, USA). PCR analysis Each extracted DNA product was used as a template for exon 21 of EGFR gene PCR amplification. The primers used for PCR are as follows: forward primer: 5″ CCTCACAGCAGGGTCTTCTCTG 3″, reverse primer: 5″ TGGCTGACCTAAAGCCACCTC 3″. PCR product size is 210 bp. The total volume of the PCR reaction system is 40 μl, including 100 ng extracted DNA template, 20 μl PCR Master Mix (Takara, Japan), 2 μl (10 μmol) PCR primer pairs, and double distilled water. The PCR protocol was carried out with an initial 15 minutes denaturation step at 95°C coupled to a repeating cycle of 45 seconds at 95°C (denaturation), 30 seconds at 56°C (annealing), and 45 seconds at 72°C (extension) for 35 cycles, followed by an additional extension for 7 minutes at 72°C. The PCR products were analyzed by electrophoresis on 2% agarose gels with ethidium bromide dye. DNA sequencing analysis The PCR products were purified by gel extract kit (Axygen, USA). Purified PCR products were used as a template for DNA sequencing. The sequencing primer of exon 21 of EGFR gene is 5″-CCTCACAGCAGGGTCTTCTCTG-3″. DNA sequencing was completed by ABI3130 genetic analyzer using BigDye® Terminator v3.1 Cycle Sequencing Kit (ABI, USA). DNA sequencing results were analyzed by Chromas software. RESULTS FFPE DNA extraction Figure 1A shows gel electrophoresis of DNA extraction products from FFPE tissues of seven NSCLC patients, showing that DNA of FFPE tissues can be extracted efficiently using this method. The fragment size of the extracted DNA is about 250–500 bp (Figure 1A). The total yield of the extracted DNA from FFPE is in the range of 35–80 μg. The DNA contents met the requirements for target gene amplification for detecting gene mutation.Figure 1.: Gel electrophoresis of DNA extraction products from FFPE tissue samples using 1% Triton X-100 (A). Lane 1: DL2000 DNA Marker; Lanes 2, 3, 4, 5, 6, 7, and 8: DNA extraction from FFPE specimens of NSCLC patients. B: Gel electrophoresis of PCR products (210 bp) for EGFR exon 21 gene amplification from the extracted DNA of FFPE tissue samples. Lane 1: DL2000 DNA Marker; Lanes 2, 3, 4, 5, 6, 7, and 8: DNA extraction from FFPE specimens of NSCLC patients. C: EGFR exon 21 sequenced electrogramme of FFPE tissue samples. C, D: EGFR exon 21 normal sequencing in FFPE tissue samples. D: Heterozygosity substitution of thymidine (T) by guanine (G) in exon 21 of EGFR to generate L858R mutation in FFPE tissue samples.Figure 1B shows gel electrophoresis of PCR products for EGFR exon 21 amplification from the extracted DNA of FFPE tissues of seven NSCLC patients, showing 100% amplification success rate for 210 bp of EGFR exon 21. In the PCR reaction system for EGFR exon 21 amplification, the extracted DNA products may be used directly as a template without DNA purification, because the extracted DNA products in our method do not involve other reagents such as SDS and EDTA; these reagents used in other methods for DNA extraction from FFPE tissues may inhibit PCR reaction. DNA sequencing analysis The mutation in EGFR exon 21 in three NSCLC tissues has been discovered by PCR-DNA sequencing in this test. Substitution of thymidine (T) by guanine (G) to generate L858R mutation is heterozygous in all three NSCLC tissues (Figure 1C, 1D). The results are the same as before, which demonstrate that the method of DNA extraction from FFPE tissues for screening EGFR gene mutation is efficient. DISCUSSION FFPE human tumor tissue samples provide an important source of nucleic acids for potential use in tumor biomolecular investigations.6 DNA extraction from FFPE tissue samples was accomplished as early as 1985.7 So far, many researchs have addressed improvement at highefficiency and quality for isolating DNA from FFPE tissue so that can be suitable for downstream applications such as PCR and hybridization.8 Commercial FFPE kits have now been used in DNA extraction from FFPE tissues in some clinical applications, but regular DNA extraction using commercial kits involves some start with microtome sectioning and a series of deparaffinization steps, followed by DNA isolation and purification. It usually takes 1–2 days to be completed. In our study, DNA extraction from FFPE tissues bypasses the long and tedious overnight steps, proteinase-k digestion, DNA purification with precipitation by phenol/isopropanol, or using silica-based adsorption columns. It is a less time-consuming process that takes only 30 minutes, and it is very cheap because the reagent for DNA extraction is only 1% Triton X-100. There has been growing interest in detecting EGFR gene mutation for predicting the response of NSCLC patients to therapy with TKIs. FFPE tissues have been used during the course of detection of EGFR gene mutation. In our study, the targeted EGFR exon 21 product fragment size is 210 bp and has successfully been amplified from the extracted DNA with high amplification efficiency from seven FFPE tissues (Figure 1B). Some studies have reported the successful amplification of the DNA sequences of up to 1 kb long, but it is generally agreed that the fragments below 300 bp appear to be most appropriate for highly reproducible PCR analysis of FFPE tissues.9 The DNA sequencing analysis for EGFR exon 21 PCR product demonstrates the efficiency and specificity of screening the EGFR exon 21 mutation from DNA samples extracted using our method (Figure 1C, 1D) In conclusion, the method of DNA extraction from FFPE tissues is simple; using only 1% Triton X-100 rapidly for only 30 minutes. EGFR exon 21 can be amplified efficiently from the extracted DNA. Mutations of EGFR exon 21 can be detected from PCR products by DNA sequencing.