Abstract:Summary Synthetic promoters may be designed using short cis‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar (Populus tremula × Populus alba), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA) and Syn3‐10b‐2 (3′: GGGCCTGTGG). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

Isolation and Functional Analysis of the Poplar RbcS Gene Promoter

Evaluation of novel promoters for vascular tissue-specific gene expression in Populus

Prokaryotic Expression and Functional Analysis of 5′-Fragment of PtCDD Gene from Populus Tomentosa

Identification and Functional Characterisation of a Novel Anther-Specificltppromoter Frombrassica Campestrisssp.chinensis

Identification and preliminary analysis of a new PCP promoter from Brassica rapa ssp. chinensis

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Isolation and Characterization of a Green-Tissue Promoter from Common Wild Rice (Oryza rufipogon Griff.)

Application of a novel strong promoter from Chinese fir (Cunninghamia lanceolate) in the CRISPR/Cas mediated genome editing of its protoplasts and transgenesis of rice and poplar

Isolation of a Cotton Reversibly Glycosylated Polypeptide (ghrgp1) Promoter and Its Expression Activity in Transgenic Tobacco

Characterization of a Novel Pollen-Specific Promoter from Wheat ( Triticum Aestivum L.)

Functional Analysis of A Cotton Cellulose Synthase A4 Gene Promoter in Transgenic Tobacco Plants

Comprehensive genome-wide analyses of R2R3-MYB transcription factors and tolerance to drought stress in Populus davidiana × Populus bolleana

The B-box Transcription Factor PabBBX27 in the Regulation of Chlorophyll Biosynthesis and Photosynthesis in Poplar (populus Alba × P. Berolinensis)

Preparation of leaf protoplasts from Populus (Populus × xiaohei T. S. Hwang et Liang) and establishment of transient expression system

Isolation and Functional Characterization of a Constitutive Promoter in Upland Cotton (Gossypium hirsutum L.)

Characterization of the Poplar R2R3-MYB Gene Family and Over-Expression of PsnMYB108 Confers Salt Tolerance in Transgenic Tobacco

The phenylcoumaran benzylic ether reductase gene PtPCBER improves the salt tolerance of transgenic poplar through lignan-mediated reactive oxygen species scavenging

Molecular cloning and characterization of a brassinosteriod biosynthesis-related gene PtoCYP90D1 from Populus tomentosa

Functional Analyses of PtRDM1 Gene Overexpression in Poplars and Evaluation of Its Effect on DNA Methylation and Response to Salt Stress.

Overexpression of Populus Trichocarpa CYP85A3 Promotes Growth and Biomass Production in Transgenic Trees

Genome-wide analysis of the MYB-related transcription factor family and associated responses to abiotic stressors in Populus