Template-Free, Polymerase-Free Dna Polymerization

Y Tian,CD Mao

DOI: https://doi.org/10.1039/b501132a

IF: 4.9

2005-01-01

Chemical Communications

Abstract:A combination of a DNA ligase and a restriction endonuclease provides a DNA polymerase activity, which might suggest a novel strategy for polymer synthesis.

What problem does this paper attempt to address?

Polymerization on Solid Supports

XY Li,DG Lynn

DOI: https://doi.org/10.1002/1521-3773(20021202)41:23<4567::aid-anie4567>3.0.co;2-6

2002-01-01

Angewandte Chemie

Abstract:A powerful strategy to translate DNA directly into synthetic polymers: A solid-phase synthetic strategy is applied to DNA-templated synthesis by using immobilized native DNA octamer S(dAp)8 as a template to direct the specific polymerization of synthetic DNA analogues (T)1 and (TN)2 (see figure). The solid-supported template provides advantages in chemical amplification and purification.
Enzymatic Synthesis of Sequence‐Defined Synthetic Nucleic Acid Polymers with Diverse Functional Groups

Dehui Kong,Yi Lei,Wayland Yeung,Ryan Hili

DOI: https://doi.org/10.1002/anie.201607538

2016-01-01

Angewandte Chemie

Abstract:The development and in-depth analysis of T4 DNA ligase-catalyzed DNA templated oligonucleotide polymerization toward the generation of diversely functionalized nucleic acid polymers is described. The NNNNT codon set enables low codon bias, high fidelity, and high efficiency for the polymerization of ANNNN libraries comprising various functional groups. The robustness of the method was highlighted in the copolymerization of a 256-membered ANNNN library comprising 16 sub-libraries modified with different functional groups. This enabled the generation of diversely functionalized synthetic nucleic acid polymer libraries with 93.8 % fidelity. This process should find ready application in DNA nanotechnology, DNA computing, and in vitro evolution of functional nucleic acid polymers.
Very efficient template/primer-independent DNA synthesis by thermophilic DNA polymerase in the presence of a thermophilic restriction endonuclease.

Xingguo Liang,Kari Jensen,Maxim D Frank-Kamenetskii

DOI: https://doi.org/10.1021/bi0489614

IF: 3.321

2004-01-01

Biochemistry

Abstract:We have found that, in the presence of a thermophilic restriction endonuclease, thermophilic DNA polymerase efficiently synthesizes and amplifies DNA in the absence of any added template and primer nucleic acid under isothermal conditions. More than 10 mug of DNA can be synthesized by 1 unit of DNA polymerase in 1 h, and the reaction proceeds until available dNTPs are consumed. We used mostly the Tsp509I restriction endonuclease (recognition sequence: down arrowAATT), the TspRI restriction endonuclease (recognition sequence: NNCA(G/C)TGNNdown arrow), and Vent (exo(-)) and Vent DNA polymerase. The synthesized double-stranded DNA has a highly repetitive palindromic sequence, e.g. (AAAAATTTTT)(n) and (ATACACTGTATATACAGTGTAT)(n). In every repeating unit, there are one or two recognition sites for the restriction enzyme. Our data show that the high efficiency of the restriction-endonuclease-DNA-polymerase (RE-pol) DNA synthesis results from an efficient exponential amplification involving digestion-elongation cycles: a longer DNA with numerous recognition sites for the restriction enzyme is digested to short fragments, and the short fragments are used as seeds for elongation to synthesize longer DNA. A possible role of RE-pol DNA synthesis in the evolutionary development of genetic materials is briefly discussed.
Reversible and Chemically Programmable Micelle Assembly with DNA Block-Copolymer Amphiphiles

Zhi Li,Yi Zhang,Paige Fullhart,Chad A. Mirkin

DOI: https://doi.org/10.1021/nl049628o

IF: 10.8

2008-01-01

Nano Letters

Abstract:We report a general solid-phase synthesis strategy for a novel class of DNA block copolymer amphiphiles. The assembled spherical micelle structures exhibit recognition properties defined by their DNA sequences and can be used to build higher-ordered structures through hybridization with materials that possess complementary DNA. This work is an important step toward creating DNA modified structures that can act as phase transfer agents and carriers of nanovesicles.
Mechanism of the Nucleotidyl-Transfer Reaction in DNA Polymerase Revealed by Time-Resolved Protein Crystallography

Teruya Nakamura,Ye Zhao,Yuriko Yamagata,Yue-Jin Hua,Wei Yang

DOI: https://doi.org/10.2142/biophysics.9.31

2013-01-01

BIOPHYSICS

Abstract:Nucleotidyl-transfer reaction catalyzed by DNA polymerase is a fundamental enzymatic reaction for DNA synthesis. Until now, a number of structural and kinetic studies on DNA polymerases have proposed a two-metalion mechanism of the nucleotidyl-transfer reaction. However, the actual reaction process has never been visualized. Recently, we have followed the nucleotidyl-transfer reaction process by human DNA polymerase η using time-resolved protein crystallography. In sequence, two Mg(2+) ions bind to the active site, the nucleophile 3'-OH is deprotonated, the deoxyribose at the primer end converts from C2'-endo to C3'-endo, and the nucleophile and the α-phosphate of the substrate dATP approach each other to form the new bond. In this process, we observed transient elements, which are a water molecule to deprotonate the 3'-OH and an additional Mg(2+) ion to stabilize the intermediate state. Particularly, the third Mg(2+) ion observed in this study may be a general feature of the two-metalion mechanism.
Enzyme-free translation of DNA into sequence-defined synthetic polymers structurally unrelated to nucleic acids

Jia Niu,Ryan Hili,David R. Liu

DOI: https://doi.org/10.1038/nchem.1577

IF: 24.274

2013-03-03

Nature Chemistry

Abstract:The translation of DNA sequences into corresponding biopolymers enables the production, function and evolution of the macromolecules of life. In contrast, methods to generate sequence-defined synthetic polymers with similar levels of control have remained elusive. Here, we report the development of a DNA-templated translation system that enables the enzyme-free translation of DNA templates into sequence-defined synthetic polymers that have no necessary structural relationship with nucleic acids. We demonstrate the efficiency, sequence-specificity and generality of this translation system by oligomerizing building blocks including polyethylene glycol, α-(D)-peptides, and β-peptides in a DNA-programmed manner. Sequence-defined synthetic polymers with molecular weights of 26 kDa containing 16 consecutively coupled building blocks and 90 densely functionalized β-amino acid residues were translated from DNA templates using this strategy. We integrated the DNA-templated translation system developed here into a complete cycle of translation, coding sequence replication, template regeneration and re-translation suitable for the iterated in vitro selection of functional sequence-defined synthetic polymers unrelated in structure to nucleic acids.

chemistry, multidisciplinary
Template-dependent DNA ligation for the synthesis of modified oligonucleotides

Marcel Hollenstein,Nazarii Sabat,Andreas Stämpfli,Serena Bisagni,Filippo Sladojevich,Kurt Püntener,Steven Hanlon

DOI: https://doi.org/10.26434/chemrxiv-2023-vwwt5-v2

2024-03-27

Abstract:Chemical modification of DNA is a common strategy to improve the properties of oligonucleotides, particularly for therapeutics and nanotechnology. Existing synthetic methods essentially rely on phosphoramidite chemistry or the polymerization of nucleoside triphosphates but are limited in terms of size, scalability, and sustainability. Herein, we report a robust alternative method for the de novo synthesis of modified oligonucleotides using template-dependent DNA ligation of shortmer fragments. Our approach is based on the fast and scaled accessibility of chemically modified shortmer monophosphates as substrates for the T3 DNA ligase. This method has shown high tolerance to chemical modifications, flexibility and overall efficiency, thereby granting access to an ultimately broad range of modified oligonucleotides of different lengths (20 → 120 nucleotides). We have applied this method to the synthesis of clinically relevant antisense drugs and diversely modified ultramers. Furthermore, the designed chemoenzymatic approach has great potential for diverse applications in therapeutics and biotechnology.

Chemistry
Single-nucleotide-specific PNA-peptide ligation on synthetic and PCR DNA templates

Simon Ficht,Amos Mattes,Oliver Seitz

DOI: https://doi.org/10.1021/ja048845o

2004-08-18

Abstract:DNA-directed chemical synthesis has matured into a useful tool with applications such as fabrication of defined (nano)molecular architectures, evolution of amplifiable small-molecule libraries, and nucleic acid detection. Most commonly, chemical methods were used to join oligonucleotides under the control of a DNA or RNA template. The full potential of chemical ligation reactions can be uncovered when nonnatural oligonucleotide analogues that can provide new opportunities such as increased stability, DNA affinity, hybridization selectivity, and/or ease and accuracy of detection are employed. It is shown that peptide nucleic acid (PNA) conjugates, nonionic biostable DNA analogues, allowed the fashioning of highly chemoselective and sequence-selective peptide ligation methods. In particular, PNA-mediated native chemical ligations proceed with sequence selectivities and ligation rates that reach those of ligase-catalyzed oligodeoxynucleotide reactions. Usually, sequence-specific ligations can only be achieved by employing short-length probes, which show DNA affinities that are too low to allow stable binding to target segments in large, double-stranded DNA. It is demonstrated that the PNA-based ligation chemistry allowed the development of a homogeneous system in which rapid single-base mutation analyses can be performed even on double-stranded PCR DNA templates.
Engineering a Ligase Binding DNA Aptamer into a Templating DNA Scaffold to Guide the Selective Synthesis of Circular DNAzymes and DNA Aptamers

Yu Yan,Dingran Chang,Yongbin Xu,Yangyang Chang,Qiang Zhang,Quan Yuan,Bruno J. Salena,Yingfu Li,Meng Liu

DOI: https://doi.org/10.1021/jacs.2c12666

IF: 15

2023-01-20

Journal of the American Chemical Society

Abstract:Functional nucleic acids (FNAs), such as DNAzymes and DNA aptamers, can be engineered into circular forms for improved performance. Circular FNAs are promising candidates for bioanalytical and biomedical applications due to their intriguing properties of enhanced biological stability and compatibility with rolling circle amplification. They are typically made from linear single-stranded (ss) DNA molecules via ligase-mediated ligation. However, it remains a great challenge to synthesize circular...

chemistry, multidisciplinary
DNAzyme-powered Nucleic Acid Release from Solid Supports.

Ting Cao,Yongcheng Wang,Ye Tao,Lexiang Zhang,Ying-Lin Zhou,Xin-Xiang Zhang,John A Heyman,David A Weitz

DOI: https://doi.org/10.1039/c9cc07790a

2019-01-01

Abstract:Here, we demonstrate use of a Mg2+-dependent, site-specific DNA enzyme (DNAzyme) to cleave oligos from polyacrylamide gel beads, which is suitable for use in drop-based assays. We show that cleavage efficiency is improved by use of a tandem-repeat cleavage site. We further demonstrate that DNAzyme-released oligos function as primers in reverse transcription of cell-released mRNA.
Enzymatic DNA Synthesis by Engineering Terminal Deoxynucleotidyl Transferase

Xiaoyun Lu,Jinlong Li,Congyu Li,Qianqian Lou,Kai Peng,Bijun Cai,Ying Liu,Yonghong Yao,Lina Lu,Zhenyang Tian,Hongwu Ma,Wen Wang,Jian Cheng,Xiaoxian Guo,Huifeng Jiang,Yanhe Ma

DOI: https://doi.org/10.1021/acscatal.1c04879

IF: 12.9

2022-02-18

ACS Catalysis

Abstract:Template-free enzymatic approaches are considered the most promising solution for next-generation artificial DNA synthesis. However, the development of these technologies has been hampered by the lack of efficient enzymes specialized for stepwise nucleotide addition. By combining evolutionary analysis, high-throughput mutagenesis scanning, and rational design, we identified a terminal deoxynucleotidyl transferase from Zonotrichia albicollis (ZaTdT) and reshaped its catalytic cavity to better accommodate 3′-ONH2-modified nucleotides. The catalytic activity of the engineered ZaTdT for 3′-ONH2-dNTPs is 3 orders of magnitude higher than that of the commonly used mammalian TdT. The engineered ZaTdT enables highly efficient single-nucleotide extension of the growing oligonucleotide chain with an average stepwise yield of 98.7%, which makes it practical for de novo enzymatic DNA synthesis.

chemistry, physical
Template-directed Chemical Ligation to Obtain 3'-3' and 5'-5' Phosphodiester DNA Linkages.

Haodong Chen,Feng Du,Gangyi Chen,Frank Streckenbach,Afshan Yasmeen,Yun Zhao,Zhuo Tang

DOI: https://doi.org/10.1038/srep04595

IF: 4.6

2014-01-01

Scientific Reports

Abstract:Up to now, the direct ligation of two DNA fragments with opposite directions to obtain 3'-3' or 5'-5' phosphate ester bonds is still challenging. The only way to obtain DNA oligonucleotides containing a 3'-3' or 5'-5' inversion of polarity sites is based on professional DNA chemical synthesis. Herein, we demonstrate a convenient template-directed chemical ligation that enables 3'-3' and 5'-5' linkages of two DNA oligonucleotides. This method is based on the assembly of two oligonucleotides on a template in opposite directions through forming antiparallel and parallel duplexes simultaneously, followed by coupling with N-Cyanoimidazole under mild condition. Moreover, on the basis of DNA oligonucleotides with 5'-5' linkage obtained through our template-directed chemical ligation, we developed a new cDNA display technique for in vitro selection of functional polypeptides.
Biochemical Investigation and Engineering of a Tardigrade X Family DNA Polymerase for Template-Independent DNA Synthesis

Yee-Song Law,Nazreen Abdul Muthaliff,Yifeng Wei,Fu Lin,Huimin Zhao,Ee Lui Ang

DOI: https://doi.org/10.1021/acscatal.4c00756

IF: 12.9

2024-01-01

ACS Catalysis

Abstract:The X family of DNA polymerases (PolXs) includes the well-studied mammalian polymerases Pol beta, Pol lambda, Pol mu, and terminal deoxynucleotidyl transferase (TdT). The template-independent DNA polymerase activity of TdT has been harnessed for applications in enzymatic de novo DNA synthesis, offering a strategy to overcome the limitations of traditional phosphoramidite-based DNA synthesis methods. Close homologues of the mammalian PolXs are present in other vertebrates, while invertebrate PolXs remain unexplored. In this study, we characterize an invertebrate PolX from the extremotolerant tardigrade Ramazzottius varieornatus (RvPolX), and demonstrate that it possesses modest template-independent DNA polymerase activity, despite limited homology to mammalian PolXs (21% sequence identity with TdT). Through a combination of structural modeling, targeted mutagenesis of active site residues, and high-throughput screening under stringent high salt conditions, we identified a synergistic combination of two mutations (G513A and R522I) that led to a significant increase in activity for the incorporation of all four nucleotides, particularly dATP (similar to 35-fold), yielding a salt-tolerant polymerase with overall higher activity and substrate promiscuity. Under high salt conditions, the engineered RvPolX displays an activity comparable to TdT and a nucleotide selectivity complementary to TdT. As a template-independent polymerase with a low homology to TdT, RvPolX provides an alternative scaffold for further engineering in various biotechnological applications.
A New Architecture for DNA‐Templated Synthesis in Which Abasic Sites Protect Reactants from Degradation

Jennifer Frommer,Robert Oppenheimer,Benjamin M. Allott,Samuel Núñez-Pertíñez,Thomas R. Wilks,Liam R. Cox,Jonathan Bath,Rachel K. O’Reilly,Andrew Jonathan Turberfield

DOI: https://doi.org/10.1002/anie.202317482

2024-02-14

Angewandte Chemie International Edition

Abstract:The synthesis of artificial sequence-defined polymers that match and extend the functionality of proteins is an important goal in materials science. One way of achieving this is to program a sequence of chemical reactions between precursor building blocks by means of attached oligonucleotide adapters. However, hydrolysis of the reactive building blocks has so far limited the length and yield of product that can be obtained using DNA-templated reactions. Here, we report an architecture for DNA-templated synthesis in which reactants are tethered at internal abasic sites on opposite strands of a DNA duplex. We show that an abasic site within a DNA duplex can protect a nearby thioester from degradation, significantly increasing the yield of a DNA-templated reaction. This protective effect has the potential to overcome the challenges associated with programmable sequence-controlled synthesis of long non-natural polymers by extending the lifetime of the reactive building blocks.

chemistry, multidisciplinary
Expanding the Materials Space of DNA via Organic-Phase Ring-Opening Metathesis Polymerization

Xuyu Tan,Hao Lu,Yehui Sun,Xiaoying Chen,Dali Wang,Fei Jia,Ke Zhang

DOI: https://doi.org/10.1016/j.chempr.2019.03.023

IF: 23.5

2019-01-01

Chem

Abstract:Here, we develop a facile route to bring DNA to the organic phase, which greatly expands the types of structures accessible via DNA macromonomers. Phosphotriester- and exocyclic-amine-protected DNA was synthesized and further modified with a norbornene moiety, which enables homopolymerization via ring-opening metathesis to produce brush-type DNA graft polymers in high yields. Subsequent deprotection cleanly reveals the natural phosphodiester DNA. The method not only achieves high molecular weight DNA graft polymers but, when carried out at low monomer-to-catalyst ratios, also yields oligomers that can be further fractionated to molecularly pure, monodisperse entities with one through ten DNA strands per molecule. In addition, we demonstrate substantial simplification in the preparation of traditionally difficult DNA-containing structures, such as DNA-poly(ethylene glycol) diblock graft copolymers and DNA amphiphiles. We envision that the marriage of oligonucleotides with the vast range of organic-phase polymerizations will result in many new classes of materials with yet unknown properties.
Step-Growth Control in Template-Directed Polymerization

Xiaoyu Li,Andres F. Hernandez,Martha A. Grover,Nicholas V. Hud,David G. Lynn

DOI: https://doi.org/10.3987/com-10-s(e)99

IF: 0.6

2010-01-01

Heterocycles

Abstract:A self-organizing process is described that combines DNA template association thermodynamics and kinetic reductive amination to translate polymer sequence information into amine nucleoside polymers. The developed kinetic model analyses allowed this process to be extended to the translation of templates as long as catalytic ribozymes.
DNA Polymerase-Endonuclease Efficiently Synthesizes DNA to Prepare DNA Materials and Develop Novel Signal Amplification System

Shun Zhang,Ning Zhou,Jiao Chen,Quan Li,Yang Wang,Wen Sun,ChuanZhu Lv

DOI: https://doi.org/10.1021/acs.analchem.4c01964

2024-06-04

Abstract:DNA biosynthesis, a focus of fundamental and applied research, typically involves DNA polymerases by using templates, primers, and dNTPs. Some polymerases can polymerize dNTPs for DNA de novo synthesis, although this is generally to occur randomly. This novel synthesis method has garnered our attention and practical use. Herein, we observed that the addition of endonuclease significantly enhances the efficiency of the de novo synthesis reaction catalyzed by the DNA polymerase. We further investigated the reaction conditions that influence this efficiency. Building on the optimal reaction conditions, we developed a rapid and efficient strategy for preparing DNA hydrogel. Further, coupled with the CRISPR-Cas system, we developed a nucleic acid signal amplification system characterized by versatility, sensitivity, specificity, and no risk of aerosol contamination. We successfully detected viral nucleic acids in clinical samples. In summary, our study demonstrates the significant potential of DNA polymerase- and endonuclease-catalyzed DNA de novo synthesis in diverse applications.
Engineering the Activity of a Template-Independent DNA Polymerase

Marija Milisavljevic,Teresa Rojas Rodriguez,Courtney K Carlson,Chang C Liu,Keith E J Tyo

DOI: https://doi.org/10.1021/acssynbio.4c00255

2024-08-16

Abstract:Enzymatic DNA writing technologies based on the template-independent DNA polymerase terminal deoxynucleotidyl transferase (TdT) have the potential to advance DNA information storage. TdT is unique in its ability to synthesize single-stranded DNA de novo but has limitations, including catalytic inhibition by ribonucleotide presence and slower incorporation rates compared to replicative polymerases. We anticipate that protein engineering can improve, modulate, and tailor the enzyme's properties, but there is limited information on TdT sequence-structure-function relationships to facilitate rational approaches. Therefore, we developed an easily modifiable screening assay that can measure the TdT activity in high-throughput to evaluate large TdT mutant libraries. We demonstrated the assay's capabilities by engineering TdT mutants that exhibit both improved catalytic efficiency and improved activity in the presence of an inhibitor. We screened for and identified TdT variants with greater catalytic efficiency in both selectively incorporating deoxyribonucleotides and in the presence of deoxyribonucleotide/ribonucleotide mixes. Using this information from the screening assay, we rationally engineered other TdT homologues with the same properties. The emulsion-based assay we developed is, to the best of our knowledge, the first high-throughput screening assay that can measure TdT activity quantitatively and without the need for protein purification.
Programming Protein Polymerization with DNA.

Janet R McMillan,Oliver G Hayes,Jonathan P Remis,Chad A Mirkin

DOI: https://doi.org/10.1021/jacs.8b10011

IF: 15

2018-01-01

Journal of the American Chemical Society

Abstract:A strategy that utilizes DNA for controlling the association pathway of proteins is described. This strategy uses sequence-specific DNA interactions to program energy barriers for polymerization, allowing for either step-growth or chain-growth pathways to be accessed. Two sets of mutant green fluorescent protein (mGFP)-DNA monomers with single DNA modifications have been synthesized and characterized. Depending on the deliberately controlled sequence and conformation of the appended DNA, these monomers can be polymerized through either a step-growth or chain-growth pathway. Cryo-electron microscopy with Volta phase plate technology enables the visualization of the distribution of the oligomer and polymer products, and even the small mGFP-DNA monomers. Whereas cyclic and linear polymer distributions were observed for the step-growth DNA design, in the case of the chain-growth system linear chains exclusively were observed, and a dependence of the chain length on the concentration of the initiator strand was noted. Importantly, the chain-growth system possesses a living character whereby chains can be extended with the addition of fresh monomer. This work represents an important and early example of mechanistic control over protein assembly, thereby establishing a robust methodology for synthesizing oligomeric and polymeric protein-based materials with exceptional control over architecture.
De novo DNA synthesis using polymerase-nucleotide conjugates

Sebastian Palluk,Daniel H Arlow,Tristan de Rond,Sebastian Barthel,Justine S Kang,Rathin Bector,Hratch M Baghdassarian,Alisa N Truong,Peter W Kim,Anup K Singh,Nathan J Hillson,Jay D Keasling

DOI: https://doi.org/10.1038/nbt.4173

IF: 46.9

2018-06-18

Nature Biotechnology

Abstract:An enzymatic approach enables synthesis of a defined DNA sequence using TdT with reversibly tethered dNTPs.

biotechnology & applied microbiology

Template-Free, Polymerase-Free Dna Polymerization

Polymerization on Solid Supports

Enzymatic Synthesis of Sequence‐Defined Synthetic Nucleic Acid Polymers with Diverse Functional Groups

Very efficient template/primer-independent DNA synthesis by thermophilic DNA polymerase in the presence of a thermophilic restriction endonuclease.

Reversible and Chemically Programmable Micelle Assembly with DNA Block-Copolymer Amphiphiles

Mechanism of the Nucleotidyl-Transfer Reaction in DNA Polymerase Revealed by Time-Resolved Protein Crystallography

Enzyme-free translation of DNA into sequence-defined synthetic polymers structurally unrelated to nucleic acids

Template-dependent DNA ligation for the synthesis of modified oligonucleotides

Single-nucleotide-specific PNA-peptide ligation on synthetic and PCR DNA templates

Engineering a Ligase Binding DNA Aptamer into a Templating DNA Scaffold to Guide the Selective Synthesis of Circular DNAzymes and DNA Aptamers

DNAzyme-powered Nucleic Acid Release from Solid Supports.

Enzymatic DNA Synthesis by Engineering Terminal Deoxynucleotidyl Transferase

Template-directed Chemical Ligation to Obtain 3'-3' and 5'-5' Phosphodiester DNA Linkages.

Biochemical Investigation and Engineering of a Tardigrade X Family DNA Polymerase for Template-Independent DNA Synthesis

A New Architecture for DNA‐Templated Synthesis in Which Abasic Sites Protect Reactants from Degradation

Expanding the Materials Space of DNA via Organic-Phase Ring-Opening Metathesis Polymerization

Step-Growth Control in Template-Directed Polymerization

DNA Polymerase-Endonuclease Efficiently Synthesizes DNA to Prepare DNA Materials and Develop Novel Signal Amplification System

Engineering the Activity of a Template-Independent DNA Polymerase

Programming Protein Polymerization with DNA.

De novo DNA synthesis using polymerase-nucleotide conjugates