Abstract:An essential factor of the DNA damage response is 53BP1, a multimeric protein that inhibits the resection-dependent double-strand break (DBS) repair. The p53 protein is a tumor suppressor known as a guardian of the genome. Although the interaction between 53BP1 and its p53 partner is well-known in regulating gene expression, a question remains whether genome injury can affect the interaction between 53BP1 and p53 proteins or p53 binding to DNA. Here, using mass spectrometry, we determine post-translational modifications and interaction properties of 53BP1 and p53 proteins in non-irradiated and γ-irradiated cells. In addition, we used Atomic Force Microscopy (AFM) and Fluorescent Lifetime Imaging Microscopy combined with Fluorescence Resonance Energy Transfer (FLIM-FRET) for studies of p53 binding to DNA. Also, we used local laser microirradiation as a tool of advanced confocal microscopy, showing selected protein accumulation at locally induced DNA lesions. We observed that 53BP1 and p53 proteins accumulate at microirradiated chromatin but with distinct kinetics. The density of 53BP1 (53BP1pS1778) phosphorylated form was lower in DNA lesions than in the non-specified form. By mass spectrometry, we found 22 phosphorylations, 4 acetylation sites, and methylation of arginine 1355 within the DNA-binding domain of the 53BP1 protein (aa1219-1711). The p53 protein was phosphorylated on 8 amino acids and acetylated on the N-terminal domain. Post-translational modifications (PTMs) of 53BP1 were not changed in cells exposed to γ-radiation, while γ-rays increased the level of S6ph and S15ph in p53. Interaction analysis showed that 53BP1 and p53 proteins have 54 identical interaction protein partners, and AFM revealed that p53 binds to both non-specific and TP53-specific sequences (AGACATGCCTA GGCATGTCT). Irradiation by γ-rays enhanced the density of the p53 protein at the AGACATGCCTAGGCATGTCT region, and the binding of p53 S15ph to the TP53 promoter was potentiated in irradiated cells. These findings show that γ-irradiation, in general, strengthens the binding of phosphorylated p53 protein to the encoding gene.

Identification Of Radiation-Induced Cross-Linking Between Thymine And Tryptophan By Electrospray Ionization-Mass Spectrometry

Mass Spectrometry-Based Quantification of the Cellular Response to Ultraviolet Radiation in HeLa Cells.

Photosensitized splitting of Cis-syn 1,3-dimethylthymine dimer by tryptophan and its peptides

H2AX post-translational modifications in the ionizing radiation response and homologous recombination.

Thymine dissociation and dimer formation: A Raman and synchronous fluorescence spectroscopic study

Quasi-Free Electron-Mediated Radiation Sensitization by C5-Halopyrimidines

Functional Characterization of TIP60 Sumoylation in UV-irradiated DNA Damage Response.

Quantitative Proteomics Analysis of the Effects of Ionizing Radiation in Wild Type and P53k317r Knock-in Mouse Thymocytes

Hydroxylation of 3-nitrotyrosine and its derivatives by gamma irradiation.

Method for Identification of Threonine Isoforms in Peptides by Ultraviolet Photofragmentation of Cold Ions

Mass Spectrometric Proteomics Reveals That Nuclear Protein Positive Cofactor PC4 Selectively Binds to Cross-Linked DNA by a Trans-Platinum Anticancer Complex

Intermolecular electron transfer involving phosphoryl and nonphosphoryl methionine and tryptophan, a pulse radiolysis study

DNA Damage Induced by Low-Energy Electrons: Conversion of Thymine to 5,6-Dihydrothymine in the Oligonucleotide Trimer TpTpT

A Theoretical Exploration of the Photoinduced Breaking Mechanism of the Glycosidic Bond in Thymine Nucleotide

A tyrosine, histidine-selective bifunctional cross-linker for protein structure analysis

Irradiation potentiates p53 phosphorylation and p53 binding to the promoter and coding region of the TP53 gene

DNA Radiosensitization by Terpyridine-Platinum: Damage Induced by 5 and 10 Ev Transient Anions

Evaluation of the efficacy of radiation-modifying compounds using γH2AX as a molecular marker of DNA double-strand breaks

Changes in molecular conformation and electronic structure of DNA under 12 C ions based on first-principles calculations

Synthesis and Electrospray Ionization Mass Spectra of Amino Acid Thiophosphoramidates of Nucleoside

Identification and characterization of a small inhibitory peptide that can target DNA-PKcs autophosphorylation and increase tumor radiosensitivity.