Imaging methods for haemostasis research

Lars Faxälv

Abstract:Blood is a vital part of the human physiology; a transport system that brings nutrients and oxygen to sustain living cells and simultaneously facilitates the removal of carbon dioxide and other was ...

What problem does this paper attempt to address?

Development of an inducible secretory expression system in Bacillus licheniformis based on an engineered xylose operon.

Youran Li,Ke Jin,Liang Zhang,Zhongyang Ding,Zhenghua Gu,Guiyang Shi

DOI: https://doi.org/10.1021/acs.jafc.8b02857

IF: 6.1

2018-01-01

Journal of Agricultural and Food Chemistry

Abstract:The xylose operon can be an efficient biological component for regulatory expression uses in Bacillus licheniformis. However, its characteristic susceptibility to carbon catabolite repression (CCR) makes its application inconvenient. In this study, plasmids harboring the wild-type operons from three Bacillus species were constructed and introduced into B. licheniformis. These plasmids ensured secretory expression of maltogenic alpha-amylase (BLMA) in B. licheniformis under strict regulation. The glucose-mediated CCR was then alleviated by engineering the xylose operon of the expression system. Evidence showed that mutations in the highly conserved nucleotides of the identified catabolite responsive element (cre) consensus sequence prevented association of the regulator CcpA with DNA, thus resulting in an increase in BLMA activity of up to 12 fold. Furthermore, features of this engineered system for inducible expression were investigated. Induction in mid-log phase using 10 g/L xylose at 37 degrees C was found to be beneficial for promoting the accumulation of recombinant product, and the maximum yield of BlmMA reached 715.4 U/mL. This study contributes to the industrial application of the generally recognized as safe (GRAS) workhorse B. licheniformis.
Efficient Production of Xylitol by the Integration of Multiple Copies of Xylose Reductase Gene and the Deletion of Embden–Meyerhof–Parnas Pathway-Associated Genes to Enhance NADPH Regeneration in Escherichia Coli

Xinsong Yuan,Jiping Wang,Jianping Lin,Lirong Yang,Mianbin Wu

DOI: https://doi.org/10.1007/s10295-019-02169-3

2019-01-01

Journal of Industrial Microbiology & Biotechnology

Abstract:Cofactor supply is a rate-limiting step in the bioconversion of xylose to xylitol. Strain WZ04 was first constructed by a novel simultaneous deletion-insertion strategy, replacing ptsG, xylAB and ptsF in wild-type Escherichia coli W3110 with three mutated xylose reductase genes (xr) from Neurospora crassa. Then, the pfkA, pfkB, pgi and/or sthA genes were deleted and replaced by xr to investigate the influence of carbon flux toward the pentose phosphate pathway and/or transhydrogenase activity on NADPH generation. The deletion of pfkA/pfkB significantly improved NADPH supply, but minimally influenced cell growth. The effects of insertion position and copy number of xr were examined by a quantitative real-time PCR and a shake-flask fermentation experiment. In a fed-batch fermentation experiment with a 15-L bioreactor, strain WZ51 produced 131.6 g L-1 xylitol from hemicellulosic hydrolysate (xylitol productivity: 2.09 g L-1 h(-1)). This study provided a potential approach for industrial-scale production of xylitol from hemicellulosic hydrolysate.
Construction Of A Glucose And Xylose Co-Fermenting Industrial Saccharomyces Cerevisiae By Expression Of Codon-Optimized Fungal Xylose Isomerase

Jianliang Yu,Deepak Singh,Nan Liu,Jieni Lian,Tianwei Tan,Shulin Chen

DOI: https://doi.org/10.1166/jbmb.2011.1163

2011-01-01

Journal of Biobased Materials and Bioenergy

Abstract:Recombinant Saccharomyces cerevisiae with the xylose reductase/xylose dehydrogenase pathway is often not well-adapted for growth on xylose, due to cofactors regeneration and balance limitations. Alternatively, several fungal xylose isomerase (xylA) genes were reported successfully expressed in S. cerevisiae. To verify the potential of such an application, and optimize the xylose isomerase expression level, a codon-optimized fungal xylA was integrated into the genome of an industrial S. cerevisiae. The host strain cannot survive in media with xylose as the sole carbon source when oxygen is limited. With xylA expression, the modified strain MYI can grow on xylose when oxygen-limited, utilizing more than 90% of xylose. With initial xylose concentration of 46.1 g/L, strain MYI produced 11.4 g/L ethanol, 0.39 g/L glycerol, and 0.078 g/L xylitol in 168 h. During co-fermentation of 20 g/L glucose and 30 g/L xylose, the final ethanol concentration reached 14.5 g/L with a yield of 0.3 g/g on consumed xylose. As expected, the final concentrations of xylitol were very low, 0.078 g/L for xylose fermentation and 0.3 g/L for co-fermentation. These results indicate that S. cerevisiae expressing codon-optimized xylose isomerase does circumvent the redox imbalance and convert xylose into xylulose. Specific ethanol productivity may be limited by single copy integration of xylA, and low activity of the endogenous xylulose kinase; further investigation and engineering may be able to overcome these limitations.
Characterization of Promoters in Escherichia Coli and Application for Xylitol Synthesis

Cuiwei Wang,Zhe Li,Aamir Rasool,Hongnan Qu,Dazhang Dai,Chun Li

DOI: https://doi.org/10.1016/j.cjche.2014.10.018

2015-01-01

Abstract:Promoters are the most important tools to control and regulate the gene expression in synthetic biology and metabolic engineering. The expression of target genes in Escherichia coli is usually controlled by the high-strength inducible promoter with the result that the abnormally high transcription of these genes creates excessive metabolic load on the host, which decreases product formation. The constitutive expression systems are capable of avoiding these defects. In this study, to enrich the application of constitutive promoters in metabolic engineering, four promoters from the glycolytic pathway of E. coli were cloned and characterized using the enhanced green fluorescent protein as reporter. Among these promoters, PgapA was determined as the strongest one, the strength of which was about 8.92% of that of the widely used inducible promoter PT7. This promoter was used to control the expression of heterologous xylose reductase in E. coli for xylitol synthesis so as to verify its function in pathway engineering. The maximum xylitol titer (40.6 g·L− 1) produced by engineered E. coli under the control of the constitutive promoter PgapA was obviously higher than that under the control of the inducible promoter PT7, indicating the feasibility and superiority of promoter PgapA in the metabolic engineering of E. coli.
Analysis of Xylose Operon from Paenibacillus polymyxa ATCC842 and Development of Tools for Gene Expression

Zilong Wang,Yakun Fang,Yi Shi,Yu Xin,Ting Yang,Youran Li,Zhongyang Ding,Guiyang Shi,Liang Zhang,Zhenghua Gu

DOI: https://doi.org/10.3390/ijms23095024

IF: 5.6

2022-05-01

International Journal of Molecular Sciences

Abstract:With numerous industrial applications, Paenibacillus polymyxa has been accepted as the candidate of the cell factory for many secondary metabolites. However, as the regulatory expression elements in P. polymyxa have not been systematically investigated, genetic modification on account of a specific metabolism pathway for the strain is limited. In this study, a xylose-inducible operon in the xylan-utilizing bacterium ATCC842 was identified, and the relative operon transcription was increased to 186-fold in the presence of xylose, while the relative enhanced green fluorescent protein (eGFP) fluorescence intensity was promoted by over four-fold. By contrast, glucose downregulated the operon to 0.5-fold that of the control. The binding site of the operon was "ACTTAGTTTAAGCAATAGACAAAGT", and this can be degenerated to "ACTTWGTTTAWSSNATAVACAAAGT" in Paenibacillus spp., which differs from that in the Bacillus spp. xylose operon. The xylose operon binding site was transplanted to the constitutive promoter Pshuttle-09. The eGFP fluorescence intensity assay indicated that both the modified and original Pshuttle-09 had similar expression levels after induction, and the expression level of the modified promoter was decreased to 19.8% without induction. This research indicates that the operon has great potential as an ideal synthetic biology tool in Paenibacillus spp. that can dynamically regulate its gene circuit strength through xylose.

biochemistry & molecular biology,chemistry, multidisciplinary
Employing a combinatorial expression approach to characterize xylose utilization in Saccharomyces cerevisiae

Luke N. Latimer,Michael E. Lee,Daniel Medina-Cleghorn,Rebecca A. Kohnz,Daniel K. Nomura,John E. Dueber

DOI: https://doi.org/10.1016/j.ymben.2014.06.002

IF: 8.4

2014-09-01

Metabolic Engineering

Abstract:Fermentation of xylose, a major constituent of lignocellulose, will be important for expanding sustainable biofuel production. We sought to better understand the effects of intrinsic (genotypic) and extrinsic (growth conditions) variables on optimal gene expression of the Scheffersomyces stipitis xylose utilization pathway in Saccharomyces cerevisiae by using a set of five promoters to simultaneously regulate each gene. Three-gene (xylose reductase, xylitol dehydrogenase (XDH), and xylulokinase) and eight-gene (expanded with non-oxidative pentose phosphate pathway enzymes and pyruvate kinase) promoter libraries were enriched under aerobic and anaerobic conditions or with a mutant XDH with altered cofactor usage. Through characterization of enriched strains, we observed (1) differences in promoter enrichment for the three-gene library depending on whether the pentose phosphate pathway genes were included during the aerobic enrichment; (2) the importance of selection conditions, where some aerobically-enriched strains underperform in anaerobic conditions compared to anaerobically-enriched strains; (3) improved growth rather than improved fermentation product yields for optimized strains carrying the mutant XDH compared to the wild-type XDH.

biotechnology & applied microbiology
Embryonic Stem Cells: Good to the Bone?

M. Eisenstein

DOI: https://doi.org/10.1038/laban0504-10b

2004-05-01

Lab Animal

Abstract:
Augmented peritoneal mass transport with intraperitoneal nitroprusside.

P. Hirszel,J. Maher,M. Chamberlin

DOI: https://doi.org/10.3109/08860227809079313

Journal of Dialysis

Abstract:Lightly restrained, alert New Zealand white rabbits underwent peritoneal dialysis by percutaneous instillation of standard dialysis solution with or without intraperitoneal nitroprusside. Corrected to a mean intraperitoneal dwell time of 36 minutes, mean clearances of creatinine and urea were 0.74 and 0.90 ml/kg/min in six rabbits. With intraperitoneal nitroprusside, 1.13 mg/kg clearances increased to 1.13 and 1.30 ml/kg/min (p less than 0.01) respectively. The 53% increment in creatinine clearance maintained the ratio clearance larger/smaller solute suggesting increased peritoneal permeability and/or area. Lower nitroprusside doses were less effective and not significantly above control. Nitroprusside also increased clearances during hypertonic peritoneal dialysis, but had no effect on osmotically induced water flux. Lavage studies demonstrated a persistent effect of nitroprusside after a single exposure and a sustained effect with repeated use.
Combining Gal4p-mediated Expression Enhancement and Directed Evolution of Isoprene Synthase to Improve Isoprene Production in Saccharomyces Cerevisiae

Fan Wang,Xiaomei Lv,Wenping Xei,Pingping Zhou,Yongqiang Zhu,Zhen Yao,Chengcheng Yang,Xiaohong Yang,Lidan Ye,Hongwei Yu

DOI: https://doi.org/10.1016/j.ymben.2016.12.011

IF: 8.4

2017-01-01

Metabolic Engineering

Abstract:Current studies on microbial isoprene biosynthesis have mostly focused on regulation of the upstream mevalonic acid (MVA) or methyl-erythritol-4-phosphate (MEP) pathway. However, the downstream bottleneck restricting isoprene biosynthesis capacity caused by the weak expression and low activity of plant isoprene synthase (ISPS) under microbial fermentation conditions remains to be alleviated. Here, based on a previously constructed Saccharomyces cerevisiae strain with enhanced precursor supply, we strengthened the downstream pathway through increasing both the expression and activity of ISPS to further improve isoprene production. Firstly, a two-level expression enhancement system was developed for the PGAL1-controlled ISPS by overexpression of GAL 4. Meanwhile, the native GAL1/7/10 promoters were deleted to avoid competition for the transcriptional activator Gal4p, and GAL80 was disrupted to eliminate the dependency of gene expression on galactose induction. The IspS expression was obviously elevated upon enhanced Gal4p supply, and the isoprene production was improved from 6.0mg/L to 23.6mg/L in sealed-vial cultures with sucrose as carbon source. Subsequently, a novel high-throughput screening method was developed based on precursor toxicity and used for ISPS directed evolution towards enhanced catalytic activity. Combinatorial mutagenesis of the resulting ISPS mutants generated the best mutant ISPSM4, introduction of which into the GAL4-overexpressing strain YXM29 achieved 50.2mg/L of isoprene in sealed vials, and the isoprene production reached 640mg/L and 3.7g/L in aerobic batch and fed-batch fermentations, respectively. These results demonstrated the effectiveness of the proposed combinatorial engineering strategy in isoprene biosynthesis, which might also be feasible and instructive for biotechnological production of other valuable chemicals.
Enhancement of Simultaneous Xylose and Glucose Utilization by Regulating ZWF1 and PGI1 in Saccharomyces Cerevisiae

Gaogang Liu,Bingzhi Li,Chun Li,Yingjin Yuan

DOI: https://doi.org/10.1007/s12209-017-0048-z

2017-01-01

Transactions of Tianjin University

Abstract:Xylose utilization is one of the key issues in lignocellulose bioconversion. Because of glucose repression, in most engineered yeast with heterogeneous xylose metabolic pathway, xylose is not consumed until glucose is completely utilized. Although simultaneous glucose and xylose utilization have been achieved in yeast by RPE1 deletion, we regulated ZWF1 and PGI1 transcription to improve simultaneous xylose and glucose utilization by controlling the metabolic flux from glucose into the PP pathway. Xylose and glucose consumption increased by approximately 80 and 72%, respectively, whereas ZWF1 was overexpressed by multi-copy plasmids with a strong transcriptional promoter. PGI1 expression was knocked down by promoter replacement; the glucose and xylose metabolism increased when PGI1p was replaced by weak promoters, SSA1p and PDA1p. ZWF1 overexpression decreased while PGI1 down-regulation increased the ethanol yield to some extent in the recombinant strains.
A Synthetic Hybrid Promoter for Xylose-Regulated Control of Gene Expression in Saccharomyces Yeasts

Ronald E. Hector,Jeffrey A. Mertens

DOI: https://doi.org/10.1007/s12033-016-9991-5

2016-12-23

Molecular Biotechnology

Abstract:Metabolism of non-glucose carbon sources is often highly regulated at the transcriptional and post-translational levels. This level of regulation is lacking in Saccharomyces cerevisiae strains engineered to metabolize xylose. To better control transcription in S. cerevisiae, the xylose-dependent, DNA-binding repressor (XylR) from Caulobacter crescentus was used to block transcription from synthetic promoters based on the constitutive Ashbya gossypii TEF promoter. The new hybrid promoters were repressed in the absence of xylose and showed up to a 25-fold increase in the presence of xylose. Activation of the promoter was highly sensitive to xylose with activity seen at concentrations below 2 μM xylose. These new xylose-inducible promoters allow improved control of gene expression for engineered strains of Saccharomyces yeasts.

biochemistry & molecular biology,biotechnology & applied microbiology
Parageobacillus thermoglucosidasius Strain Engineering Using a Theophylline Responsive RiboCas for Controlled Gene Expression

Matthew S. H. Lau,Abubakar Madika,Ying Zhang,Nigel P. Minton

DOI: https://doi.org/10.1021/acssynbio.3c00735

IF: 5.249

2024-03-23

ACS Synthetic Biology

Abstract:The relentless increase in atmospheric greenhouse gas concentrations as a consequence of the exploitation of fossil resources compels the adoption of sustainable routes to chemical and fuel manufacture based on biological fermentation processes. The use of thermophilic chassis in such processes is an attractive proposition; however, their effective exploitation will require improved genome editing tools. In the case of the industrially relevant chassis Parageobacillus thermoglucosidasius,...

biochemical research methods
Heterologous xylose isomerase pathway and evolutionary engineering improve xylose utilization in Saccharomyces cerevisiae

Xin Qi,Jian Zha,Gao-Gang Liu,Weiwen Zhang,Bing-Zhi Li,Ying-Jin Yuan

DOI: https://doi.org/10.3389/fmicb.2015.01165

IF: 5.2

2015-10-21

Frontiers in Microbiology

Abstract:Xylose utilization is one key issue for the bioconversion of lignocelluloses. It is a promising approach to engineering heterologous pathway for xylose utilization in Saccharomyces cerevisiae. Here, we constructed a xylose-fermenting yeast SyBE001 through combinatorial fine-tuning the expression of XylA and endogenous XKS1. Additional overexpression of genes RKI1, RPE1, TKL1, and TAL1 in the non-oxidative pentose phosphate pathway (PPP) in SyBE001 increased the xylose consumption rate by 1.19-fold. By repetitive adaptation, the xylose utilization rate was further increased by ∼10-fold in the resultant strain SyBE003. Gene expression analysis identified a variety of genes with significantly changed expression in the PPP, glycolysis and the tricarboxylic acid cycle in SyBE003.

microbiology
Discovering a novel D-xylonate-responsive promoter: the PyjhI-driven genetic switch towards better 1,2,4-butanetriol production

Angelo B Bañares,Kris Niño G Valdehuesa,Kristine Rose M Ramos,Grace M Nisola,Won-Keun Lee,Wook-Jin Chung

DOI: https://doi.org/10.1007/s00253-019-10073-0

Abstract:The capability of Escherichia coli to catabolize D-xylonate is a crucial component for building and optimizing the Dahms pathway. It relies on the inherent dehydratase and keto-acid aldolase activities of E. coli. Although the biochemical characteristics of these enzymes are known, their inherent expression regulation remains unclear. This knowledge is vital for the optimization of D-xylonate assimilation, especially in addressing the problem of D-xylonate accumulation, which hampers both cell growth and target product formation. In this report, molecular biology techniques and synthetic biology tools were combined to build a simple genetic switch controller for D-xylonate. First, quantitative and relative expression analysis of the gene clusters involved in D-xylonate catabolism were performed, revealing two D-xylonate-inducible operons, yagEF and yjhIHG. The 5'-flanking DNA sequence of these operons were then subjected to reporter gene assays which showed PyjhI to have low background activity and wide response range to D-xylonate. A PyjhI-driven synthetic genetic switch was then constructed containing feedback control to autoregulate D-xylonate accumulation and to activate the expression of the genes for 1,2,4-butanetriol (BTO) production. The genetic switch effectively reduced D-xylonate accumulation, which led to 31% BTO molar yield, the highest for direct microbial fermentation systems thus far. This genetic switch can be further modified and employed in the production of other compounds from D-xylose through the xylose oxidative pathway.
Open laparoscopy simplifies instrumentation required for laparoscopic oophorectomy and salpingo-oophorectomy.

P. D. Silva,M. Kuffel,E. Beguin

1991-03-01

Obstetrics and Gynecology

Abstract:Eight consecutive cases of open laparoscopic oophorectomy and salpingo-oophorectomy are reported. A modified technique that requires fewer specialized instruments and includes removal of the intact adnexa is demonstrated. Patients were not included if there was any suspicion of malignancy. Indications for surgery included chronic pelvic pain after hysterectomy (N = 5), endometriosis (N = 1), estrogen receptor-positive metastatic breast carcinoma that had not responded to chemotherapy (N = 1), and tuboovarian ectopic pregnancy (N = 1). No intraoperative or postoperative complications occurred. The average hospital stay was 1.1 days, and patients were released 3-14 days postoperatively. Five of the six patients with chronic pelvic pain had prompt resolution of their symptoms. In one patient who had a unilateral salpingo-oophorectomy, a contralateral procedure was required 3 months later because of continued chronic pelvic pain; her pain subsequently resolved. Laparoscopic salpingo-oophorectomy has the potential to decrease morbidity as compared with laparotomy in appropriately selected cases.
Engineering a carbon source-responsive promoter for improved biosynthesis in the non-conventional yeast Kluyveromyces marxianus

Shane Bassett,Nancy A Da Silva

DOI: https://doi.org/10.1016/j.mec.2024.e00238

2024-05-20

Abstract:Many desired biobased chemicals exhibit a range of toxicity to microbial cell factories, making industry-level biomanufacturing more challenging. Separating microbial growth and production phases is known to be beneficial for improving production of toxic products. Here, we developed a novel synthetic carbon-responsive promoter for use in the rapidly growing, stress-tolerant yeast Kluyveromyces marxianus, by fusing carbon-source responsive elements of the native ICL1 promoter to the strong S. cerevisiae TDH3 or native NC1 promoter cores. Two hybrids, P IT350 and P IN450 , were validated via EGFP fluorescence and demonstrated exceptional strength, partial repression during growth, and late phase activation in glucose- and lactose-based medium, respectively. Expressing the Gerbera hybrida 2-pyrone synthase (2-PS) for synthesis of the polyketide triacetic acid lactone (TAL) under the control of P IN450 increased TAL more than 50% relative to the native NC1 promoter, and additional promoter engineering further increased TAL titer to 1.39 g/L in tube culture. Expression of the Penicillium griseofulvum 6-methylsalicylic acid synthase (6-MSAS) under the control of P IN450 resulted in a 6.6-fold increase in 6-MSA titer to 1.09 g/L and a simultaneous 1.5-fold increase in cell growth. Finally, we used P IN450 to express the Pseudomonas savastanoi IaaM and IaaH proteins and the Salvia pomifera sabinene synthase protein to improve production of the auxin hormone indole-3-acetic acid and the monoterpene sabinene, respectively, both extremely toxic to yeast. The development of carbon-responsive promoters adds to the synthetic biology toolbox and available metabolic engineering strategies for K. marxianus, allowing greater control over heterologous protein expression and improved production of toxic metabolites.
Engineered xylose utilization enhances bio-products productivity in the cyanobacterium Synechocystis sp. PCC 6803

Tai-Chi Lee,Wei Xiong,Troy Paddock,Damian Carrieri,Ing-Feng Chang,Hui-Fen Chiu,Justin Ungerer,Suh-Hang Hank Juo,Pin-Ching Maness,Jianping Yu

DOI: https://doi.org/10.1016/j.ymben.2015.06.002

IF: 8.4

2015-07-01

Metabolic Engineering

Abstract:Hydrolysis of plant biomass generates a mixture of simple sugars that is particularly rich in glucose and xylose. Fermentation of the released sugars emits CO2 as byproduct due to metabolic inefficiencies. Therefore, the ability of a microbe to simultaneously convert biomass sugars and photosynthetically fix CO2 into target products is very desirable. In this work, the cyanobacterium, Synechocystis 6803, was engineered to grow on xylose in addition to glucose. Both the xylA (xylose isomerase) and xylB (xylulokinase) genes from Escherichia coli were required to confer xylose utilization, but a xylose-specific transporter was not required. Introduction of xylAB into an ethylene-producing strain increased the rate of ethylene production in the presence of xylose. Additionally, introduction of xylAB into a glycogen-synthesis mutant enhanced production of keto acids. Isotopic tracer studies found that nearly half of the carbon in the excreted keto acids was derived from the engineered xylose metabolism, while the remainder was derived from CO2 fixation.

biotechnology & applied microbiology
Fine-Tuning the Expression of the Glycolate Biosynthetic Pathway in <i>Escherichia coli</i> Using Synthetic Promoters

Mei Zhao,Jie Shang,Jiaojiao Chen,Hossain M. Zabed,Xianghui Qi

DOI: https://doi.org/10.3390/fermentation10010067

2024-01-01

Abstract:Glycolate plays an important role as a platform chemical in both polymeric material and cosmetic industries. However, the microbial production of glycolate often encounters challenges associated with unbalanced metabolic flux, leading to a notably low titer. Additionally, the use of expensive inducers, such as IPTG, contributes to an increase in the overall production cost. To address these issues, the key enzymes involved in the glycolate biosynthetic route, including citrate synthase (gltA), isocitrate lyase (aceA), isocitrate dehydrogenase kinase/phosphatase (aceK) and glyoxylate reductase (ycdW), were overexpressed in E. coli under the control of inducible promoters with varying strengths in order to determine the optimal combination. Subsequently, the glycolate pathway was further modulated by replacing inducible promoters with various constitutive synthetic promoters. Through this systematic optimization, the best strain, named Mgly4T1562, produced 3.02 g/L glycolate with 97.32% theoretical yield in shake-flask cultivation. The titer further increased to 15.53 g/L in a fed-batch experiment. Notably, this study marks the first successful utilization of synthetic promoters in tuning the glycolate biosynthetic pathway for glycolate biosynthesis. The strategy presented in this research holds significant promise for facilitating the cost-effective and industrially viable production of glycolate without the need for expensive inducers.
Generation of Pseudomonas putida KT2440 Strains with Efficient Utilization of Xylose and Galactose via Adaptive Laboratory Evolution

Hyun Gyu Lim,Thomas Eng,Deepanwita Banerjee,Geovanni Alarcon,Andrew K. Lau,Mee-Rye Park,Blake A. Simmons,Bernhard O. Palsson,Steven W. Singer,Aindrila Mukhopadhyay,Adam M. Feist

DOI: https://doi.org/10.1021/acssuschemeng.1c03765

2021-08-19

Abstract:While Pseudomonas putida KT2440 has great potential for biomass-converting processes, its inability to utilize the biomass abundant sugars xylose and galactose has limited its applications. In this study, we utilized Adaptive Laboratory Evolution (ALE) to optimize engineered KT2440 with heterologous expression of xylD encoding xylonate dehydratase from Caulobacter crescentus and galETKM encoding UDP-glucose 4-epimerase, galactose-1-phosphate uridylyltransferase, galactokinase, and galactose-1-epimerase from Escherichia coli K-12 MG1655. Poor starting strain growth (<0.1 h–1 or none) was evolutionarily optimized to rates of up to 0.25 h–1 on xylose and 0.52 h–1 on galactose. Whole-genome sequencing, transcriptomic analysis, and growth screens revealed significant roles of kguT encoding a 2-ketogluconate operon repressor and 2-ketogluconate transporter, and gtsABCD encoding an ATP-binding cassette (ABC) sugar transporting system in xylose and galactose growth conditions, respectively. Finally, we expressed the heterologous indigoidine production pathway in the evolved and unevolved engineered strains and successfully produced 3.2 g/L and 2.2 g/L from 10 g/L of either xylose or galactose in the evolved strains whereas the unevolved strains did not produce any detectable product. Thus, the generated KT2440 strains have the potential for broad application as optimized platform chassis to develop efficient microorganism-based biomass-utilizing bioprocesses.The Supporting Information is available free of charge at https://pubs.acs.org/doi/10.1021/acssuschemeng.1c03765.Pathways for glucose, xylose, and galactose utilization, growth profiles of the wildtype KT2440 and engineered strains on xylose and galactose, growth rate comparison of the wildtype KT2440 and evolved strains on glucose, cluster of orthologous groups (COG) analysis of commonly differentially expressed genes, transcripts per million of the kguT and gntT genes, gene expression levels of the galETKM genes and their neighboring genes, sequence comparison of CCNA_00866 and PP_2836, growth and sugar consumption by knockout mutants, growth test of the A1_F11_I1 and A1_F11_I1_ΔPP_2836 strains using Weimberg pathway intermediates, standard curve for indigoidine quantification, previous studies for enabling non-native sugars in P. putida strains, strains used in this study, plasmids used in this study, oligonucleotides used in this study , whole-genome sequencing sample list, mutations in the starting strains, RNA-seq sample list, summary of the ALE experiments, fold changes of TPMs of central carbon metabolism genes, mutations in the A8_F92_I1 strain (PDF)This article has not yet been cited by other publications.

chemistry, multidisciplinary,engineering, chemical,green & sustainable science & technology
Inducible high-level expression of heterologous genes in Bacillus megaterium using the regulatory elements of the xylose-utilization operon

Thomas Rygus,Wolfgang Hillen

DOI: https://doi.org/10.1007/bf00169622

IF: 5

1991-08-01

Applied Microbiology and Biotechnology

Abstract:We have constructed a shuttle plasmid for Bacillus megaterium and Escherichia coli that contains the promoter and repressor gene of the B. megaterium-borne operon for xylose utilization. A polylinker downstream of the promoter allows versatile cloning of genes under its transcriptional control. We have placed gdhA (encoding glucose dehydrogenase) from B. megaterium, lacZ (encoding β-galactosidase) from E. coli, mro (encoding mutarotase) from Acinetobacter calcoaceticus, and human puk (encoding single-chain urokinase-like plasminogen activator, rscuPA) under xylose control in this vector. All four genes were between 130-fold and 350-fold inducible by 0.5% xylose in the growth medium in B. megaterium. Enzymatically active glucose dehydrogenase and mutarotase accumulated to 20% and 30% of the total soluble protein, respectively. β-Galactosidase and rscuPA were also expressed at a high level. A gel analysis of the products demonstrated their proteolytic stability in the cytoplasm, even up to 5 h after induction. The expression properties of this new host-vector system are discussed in comparison to the ones available for B. subtilis and E. coli.

biotechnology & applied microbiology

Imaging methods for haemostasis research

Development of an inducible secretory expression system in Bacillus licheniformis based on an engineered xylose operon.

Efficient Production of Xylitol by the Integration of Multiple Copies of Xylose Reductase Gene and the Deletion of Embden–Meyerhof–Parnas Pathway-Associated Genes to Enhance NADPH Regeneration in Escherichia Coli

Construction Of A Glucose And Xylose Co-Fermenting Industrial Saccharomyces Cerevisiae By Expression Of Codon-Optimized Fungal Xylose Isomerase

Characterization of Promoters in Escherichia Coli and Application for Xylitol Synthesis

Analysis of Xylose Operon from Paenibacillus polymyxa ATCC842 and Development of Tools for Gene Expression

Employing a combinatorial expression approach to characterize xylose utilization in Saccharomyces cerevisiae

Embryonic Stem Cells: Good to the Bone?

Augmented peritoneal mass transport with intraperitoneal nitroprusside.

Combining Gal4p-mediated Expression Enhancement and Directed Evolution of Isoprene Synthase to Improve Isoprene Production in Saccharomyces Cerevisiae

Enhancement of Simultaneous Xylose and Glucose Utilization by Regulating ZWF1 and PGI1 in Saccharomyces Cerevisiae

A Synthetic Hybrid Promoter for Xylose-Regulated Control of Gene Expression in Saccharomyces Yeasts

Parageobacillus thermoglucosidasius Strain Engineering Using a Theophylline Responsive RiboCas for Controlled Gene Expression

Heterologous xylose isomerase pathway and evolutionary engineering improve xylose utilization in Saccharomyces cerevisiae

Discovering a novel D-xylonate-responsive promoter: the PyjhI-driven genetic switch towards better 1,2,4-butanetriol production

Open laparoscopy simplifies instrumentation required for laparoscopic oophorectomy and salpingo-oophorectomy.

Engineering a carbon source-responsive promoter for improved biosynthesis in the non-conventional yeast Kluyveromyces marxianus

Engineered xylose utilization enhances bio-products productivity in the cyanobacterium Synechocystis sp. PCC 6803

Fine-Tuning the Expression of the Glycolate Biosynthetic Pathway in <i>Escherichia coli</i> Using Synthetic Promoters

Generation of Pseudomonas putida KT2440 Strains with Efficient Utilization of Xylose and Galactose via Adaptive Laboratory Evolution

Inducible high-level expression of heterologous genes in Bacillus megaterium using the regulatory elements of the xylose-utilization operon