An Introduction to the Papers Presented at the NICHD Conference on Prevention of Bilirubin-Induced Brain Injury and Kernicterus

T. Raju

DOI: https://doi.org/10.1038/SJ.JP.7211155

2004-08-01

Journal of Perinatology

Abstract:

What problem does this paper attempt to address?

Association of microRNA gene polymorphisms with recurrent spontaneous abortion: An updated meta‑analysis

Chang-Zhen Zhang,Jing Gao,Xueqin Wang,Yong-Yong Wang,Y. Xing,Zhaoxia Du

DOI: https://doi.org/10.3892/etm.2023.11878

IF: 2.7

2023-03-10

Experimental and Therapeutic Medicine

Abstract:Numerous studies have reported single nucleotide polymorphisms (SNPs) in microRNAs (miRNAs) associated with unexplained recurrent spontaneous abortion (URSA). The present study aimed to conduct an updated meta-analysis to confirm a pooled effect size of the association between miRNA SNPs and URSA. The relevant literature was searched on PubMed, EMBASE, Web of Science and Cochrane Library before July 2022 to identify case-control studies. The pooled odds ratio and confidence intervals at 95% of the eligible studies were extracted and evaluated under five genetic models. A total of 18 studies involving 3,850 cases and 4,312 controls were included. miR499a rs3746444 A>G, miR-149 rs2292832 T>C, miR-125a rs41275794 G>A and miR-10a rs3809783 A>T may enhance the risk of recurrent spontaneous abortion (RSA) under various genetic models. Although no separate association was found between the miR-125a rs12976445 C>T and miR-27a rs895819 A>G polymorphisms and RSA, statistical significance was found in certain ethnic groups only. The current analysis suggests a high significance of an up-to-date meta-analysis for screening out and preventing URSA among high-risk women by testing miRNA SNPs and RSA susceptibility.

Biology,Medicine
[Relationship between IL-18 gene polymorphism and unexplained recurrent spontaneous abortion].

Dan Wang,Chen Wang,Ling-zhi Zheng,Min Zhu,Yi-min Zhu

DOI: https://doi.org/10.3785/j.issn.1008-9292.2014.06.004

2014-01-01

Abstract:OBJECTIVE:To investigate the association between IL-18 polymorphisms and the risk of unexplained recurrent spontaneous abortion (URSA). METHODS:The polymorphism of rs187238, rs360718 and rs360717 in IL-18 was determined by PCR in combination with DNA sequencing in 207 patients with URSA and 144 women with normal pregnancy. RESULTS:The frequency of gene types GG, GC+CC of rs187238 (-137 G/C) in URSA group and control group was 77.3%, 22.7%, and 95.8%, 4.2%, respectively (χ²=22.767, P<0.001). The frequency of allele C in URSA group was significantly higher than that in control groups (13.04% vs 2.1%, χ²=26.102, P<0.001) . The risk of spontaneous abortion in C allele carriers was 7.050 times higher than that in G allele carriers (OR=7.050, 95%CI: 2.990-16.622). No significant difference in genotype frequency and allele frequency of rs360718 and rs360717 polymorphism was noticed between URSA group and control group (χ²=1.497, P=0.221; χ²=0.858, P=0.354). CONCLUSION:GC+CC genotype and C allele of Rs187238 in IL-18 gene are associated with the susceptibility of recurrent spontaneous miscarriage. Rs360718 and rs360717 in IL-18 may not be associated with URSA.
Association of miR-146a and miR196a2 genotype with susceptibility to idiopathic recurrent pregnancy loss in Iranian women: A case-control study

Emad Babakhanzadeh,Hamid Danaei,Mohammad Abedinzadeh,Hamid Reza Ashrafzadeh,Nasrin Ghasemi

DOI: https://doi.org/10.18502/ijrm.v19i8.9620

2021-09-09

International Journal of Reproductive BioMedicine (IJRM)

Abstract:Background: Recurrent pregnancy loss (RPL) is the most common complaint of pregnancy in females with a prevalence of 5%. Numerous documents have shown that single nucleotide polymorphisms are able to change miRNA transcription and/or maturation, which may alter the incidence of disorders such as RPL. Objective: To assess the relationship of miR-146aC > G (rs2910164) and miR-196a2T > C (rs11614913) with RPL susceptibility in Iranian women. Materials and Methods: Blood samples were collected from 214 women who had experienced at least two consecutive spontaneous miscarriages (case) and 147 normal individuals without a history of miscarriage (control). MiR-146aC > G and miR-196a2T > C genotypes were evaluated via the restriction fragment length polymorphism technique. Results: The genotypes incidence did not show a significant difference in pre-miR-146aC > G polymorphism CC vs CG + GG (p = 0.854; OR = 0.933; 95% CI) and CC + CG vs GG (p = 0.282; OR = 1.454; 95% CI). Also, no significant difference was observed between pre-miR-196a2T > C polymorphism TT vs TC + CC (p = 0.862; OR = 0.938; 95% CI) and TT + TC vs CC and (p = 0.291; OR = 1.462; 95% CI) in both the case and control groups. Conclusion: The results showed that although the distribution of miR-146aC > G and miR-196a2T > C was different between the unknown RPL and control groups, these variances were not statistically significant. Key words: RPL, miR-146a, miR196a2, Polymorphism, RFLP.
Association of miR-146a rs2910164 and miR-499 rs3746444 polymorphisms with risk of ischemic stroke

Guotian Lyu,Shuang Wang,Qingkun Wang

DOI: https://doi.org/10.3969/j.issn.0253-9802.2016.04.012

2016-01-01

Abstract:Objective ToinvestigatetheassociationofmiR-146ars2910164andmiR-499 rs3746444singlenucleotidepolymorphismsandischemicstroke.Methods Taqman-PCRandDNAsequen-cing assays were performed to investigate the genotype and allele gene of miR-1 46a rs291 01 64 and miR-499 rs3746444 loci in 378 patients with ischemic stroke (ischemic stroke group)and 378 healthy individuals (con-trol group). The association of miR-1 46a rs291 01 64 and miR-499 rs3746444 single nucleotide polymorphisms withtheriskofischemicstrokewasassessedbylogisticregressionanalysis.Results Intheischemicstroke group,the frequency of allele G (P=0.003,OR=1.412,95%CI=1.121-1.716),genotype GG (P=0.002,OR=2.080,95%CI=1.330-3.250),CG+GG (P=0.01 1 ,OR=1.488,95%CI=1.1 1 0-2.01 2) of miR-1 46a rs291 01 64 was significantly higher compared with those in the control group. However,the fre-quency of allele gene and genotype of miR-499 rs3746444 did not significantly differ between the ischemic strokeandcontrolgroups(bothP>0.05).Conclusions ThesinglenucleotidepolymorphismofmiR-146a rs291 01 64 rather than miR-499 rs3746444 is probably correlated with the risk of ischemic stroke.
Relationship Between Cytokine Gene Polymorphisms and Recurrent Spontaneous Abortion.

Ru-Xin Liu,Ying Wang,Li-Hua Wen

2015-01-01

Abstract:Recurrent spontaneous abortion (RSA), defined as three or more sequential abortions before the twentieth week of gestation. Some studies have led to the awareness that immunological factors play an important role in establishing a successful pregnancy. The aim of present study was to investigate the relationship between RSA and polymorphisms of cytokine genes coding for TNF-α (-308 G→A, -238 G→A), TNF-β (+252 G→A) as Th1 or pro-inflammatory factors as well as IL-6 (-634 G→C, -174 G→C), IL-10 (-1082 A→G, -819 C→T, -592C→A) as Th2 cytokines in women with RSA compared with healthy women. A total of 284 women with RSA and 284 control women with at least two successful pregnancies and no history of abortion were included in the study. The polymerase chain reaction (PCR), allele-specific oligonucleotide polymerase chain reaction (ASO-PCR) or PCR-RFLP (restriction fragment length polymorphism) methods were used for genotyping. In addition, the ELISA was conducted to investigate four cytokine serum levels in women with RSA and healthy women. Results showed that: TNF-α -308G/A, IL-6 -174 G/C and IL-10 -819 G/C polymorphisms showed statistically significant differences between the RSA patients and controls (P=0.008, P=0.0005 and P=0.03 separately). Levels of four cytokines in the serum showed that there were no significant differences in TNF-α and TNF-β between patients and control (P>0.05), while the level of IL-6 and IL-10 were lower than control group and the differences were statically significant (P<0.05). This study demonstrated a possible association between TNF-α -308, IL-6 -174 and IL-10 -819 promoter polymorphism and RSA.
Gut Microbiota-Derived Metabolites Associate with Circulating Immune Cell Subsets in Unexplained Recurrent Spontaneous Abortion

Zhi Li,Yongquan Zheng,Meng Zhang,Kaiqi Wu,Long Zhang,Yao,Caihong Zheng

DOI: https://doi.org/10.1016/j.heliyon.2024.e24571

IF: 3.776

2024-01-01

Heliyon

Abstract:Currently, the precise causes of over 40 % of recurrent spontaneous abortion (RSA) cases cannot be identified, leading to the term “unexplained RSA” (URSA). Through an exploration of the gut microbiota, metabolites, and immune cell subsets in URSA, this study establishes a link between gut microbiota-derived metabolites and immune cells. The results indicate reduced diversity in the gut microbiota of URSA. Targeted metabolomic analyses reveal decreased levels of gut microbiota-derived deoxycholic acid (DCA), glycolithocholic acid (GLCA), acetate, propionate, and butyrate in URSA. Furthermore, elevated frequencies of Th1, Th17, and plasma B cells, along with decreased frequencies of Tregs and Bregs, are observed in the peripheral blood of URSA. The results demonstrate correlations between the levels of gut microbiota-derived bile acids and short-chain fatty acids and the frequencies of various immune cell subsets in circulation. Collectively, this study uncovers an association between gut microbiota-derived metabolites and circulating immune cell subsets in URSA.
miR-27a and miR-449b polymorphisms associated with a risk of idiopathic recurrent pregnancy loss

HyungChul Rah,Ki Wha Chung,Ki Han Ko,Eun Sun Kim,Jung Oh Kim,Jung Hyun Sakong,Ji Hyang Kim,Woo Sik Lee,Nam Keun Kim

DOI: https://doi.org/10.1371/journal.pone.0177160

IF: 3.7

2017-05-10

PLoS ONE

Abstract:Objective: MicroRNAs (miRNAs) regulate gene expression during the peri-implantation period. The purpose of this study was to investigate whether genetic polymorphisms in the four miRNAs associated with fetal or placental development play roles in the development of idiopathic recurrent pregnancy loss (RPL) in Korean females. Study design: A case-control study involving 225 controls and 387 women with at least two consecutively recurrent pregnancy losses between 1999 and 2012 was performed. The genotypes of the four miRNA polymorphisms, including miR-27a rs895819, miR-423 rs6505162, miR-449b rs10061133, and miR-605 rs2043556, were analyzed by the polymerase chain reaction-restriction fragment length polymorphism assay. Odds ratios and 95% confidence intervals were estimated using multivariate analyses after maternal age adjustments. The relationships between each of the four microRNA genotypes and each of the six clinical parameters of the RPL patients (plasma homocysteine and folate levels, natural killer cell number, platelet count, prothrombin time, and, activated partial thromboplastin time) were analyzed using multiple linear regression analyses. Results: Our results suggest that weak associations between decreased RPL risk and the genotypes of miR-27a (AG and AG+GG), combination genotype of miR-27a/miR-423 (AG/GC), and haplotypes of miR-27a/miR-423/miR-449b/miR-605 (G-C-A-G) and miR-27a/miR-449b/miR-605 (G-A-G), whereas weak associations between increased RPL risk and genotypes of miR-449b (GG and AG+GG), combination genotypes of miR-423/miR-449b (CC/GG and CA/AG), miR-449b/miR-605 (AG/AG), haplotypes of miR-27a/miR-423/miR-449b/miR-605 (A-C-G-A, A-A-A-G, and G-C-G-G), miR-27a/miR-423/miR-449b (A-C-G), miR-27a/miR-449b/miR-605 (A-A-G, A-G-A, and G-G-G), miR-423/miR-449b/miR-605 (C-G-G and A-A-G), and miR-423/miR-449b (C-G and A-A). The genotypes of miR-27a (AG and AG+GG) also showed significant contributions to the prediction of folate levels in RPL patients. Conclusions: The study showed associations between miRNA polymorphisms (miR-27a rs895819 and miR-449b rs10061133) and RPL development, and between the miRNA polymorphism (miR-27a rs895819) and plasma folate levels.
Meta-analysis of FOXP3 polymorphisms and recurrent spontaneous abortion susceptibility

Ruzhen Shuai,Dandan Li,Xincong Xu,Xiaojuan Yang,Dan Liu

DOI: https://doi.org/10.1111/aji.13827

Abstract:Background: The polymorphisms of the FOXP3 gene may mediate abnormalities in Tregs, leading to an imbalance in maternal-fetal immune tolerance and ultimately resulting in recurrent spontaneous abortion (RSA). This meta-analysis aims to assess the potential association between FOXP3 polymorphisms and susceptibility to RSA using five specific single nucleotide polymorphisms (SNPs). Materials and methods: By conducting a comprehensive search across databases such as EMBASE, PubMed, Web of Science, Cochrane Library, CNKI, Wanfang, and CBM, we identified suitable studies for inclusion in the meta-analysis. The data extracted from these studies were subjected to analysis using Stata SE 15. To assess the degree of association, we utilized the odds ratio (OR) along with its corresponding 95% confidence intervals (CI). Five specific single nucleotide polymorphisms (SNPs) were employed in assessing the connection between FOXP3 gene polymorphisms and RSA. Results: The meta-analysis demonstrated a significant association between several polymorphisms (rs3761548, rs2232365, rs2232368, rs2280883, and rs2294021) and susceptibility to RSA. Conversely, the FOXP3 rs5902434 polymorphism was not associated with susceptibility to RSA. Conclusion: Our meta-analysis suggests that these genetic variations within the FOXP3 gene might play a role in the progression of RSA disease. Meanwhile, large-scale studies that consider multiple factors are needed to validate this finding.
Genome-wide miRNA profiling of villus and decidua of recurrent spontaneous abortion patients.

Fulu Dong,Yuan Zhang,Fei Xia,Yi Yang,Sidong Xiong,Liping Jin,Jinping Zhang

DOI: https://doi.org/10.1530/REP-14-0095

2014-01-01

Reproduction

Abstract:MicroRNAs (miRNAs) are non-coding RNA molecules of about 22 nucleotides that involved in post-transcriptional gene regulation. Evidence indicates that miRNAs play essential roles in endometriosis, pre-eclampsia, infertility and other reproductive system diseases. However, whether miRNAs are involved in recurrent spontaneous abortion (RSA) is unclear. In this work, we analysed the miRNA expression profiles in six pairs of villus or decidua from RSA patients and normal pregnancy (NP) women using a human miRNA microarray. Some of the chip results were confirmed by RT-qPCR. In the villi of RSA patients, expression of hsa-miR-184, hsa-miR-187 and hsa-miR-125b-2 was significantly higher, while expression of hsa-miR-520f, hsa-miR-3175 and hsa-miR-4672 was significantly lower, comparing with those of NP control. As well, a total of five miRNAs (hsa-miR-517c, hsa-miR-519a-1, hsa-miR-522, hsa-miR-520h and hsa-miR-184) were upregulated in the decidua of RSA patients. The target genes of these differentially expressed miRNAs were predicted by miRWalk, and we speculate a network of miRNA regulating RSA by target genes function on adhesion, apoptosis and angiogenesis. Our study may help clarify the molecular mechanisms which are involved in the progression of RSA, and provide a reference for future research.
A Genetic Polymorphism In Pre-Mir-27a Confers Clinical Outcome Of Non-Small Cell Lung Cancer In A Chinese Population

Jiali Xu,Zhiqiang Yin,Hong Shen,Wen Gao,Yingying Qian,Dong Pei,Lingxiang Liu,Yongqian Shu

DOI: https://doi.org/10.1371/journal.pone.0079135

IF: 3.7

2013-01-01

PLoS ONE

Abstract:Background: Recent evidence indicates that microRNAs (miRNAs) can function as tumor suppressors and oncogenes. Single nucleotide polymorphisms (SNPs) at miRNA genes can influence the maturation of miRNAs or miRNA-mediated transcriptional regulation. Our objective was to investigate the association of SNPs in deregulated miRNAs with clinical outcome in patients with non-small cell lung cancer (NSCLC) in a Chinese population.Methods: Deregulated miRNAs in NSCLC and their SNPs were identified through public databases. A single SNP, rs895819 in pre-miR-27a, was found suitable for selection. TaqMan assays were performed for genotyping and to assess the effect on the overall survival (OS) and chemotherapy response in 576 NSCLC patients.Results: Log-rank test and Cox regression analysis indicated that the G allele of rs895819 was associated with shorter survival and increased risk of death in NSCLC [dominant model: 22.0 vs. 46.0 months, P<0.001; adjusted hazard ratio (HR) = 1.71, 95% confidential interval (CI): 1.12-2.26]. Further stepwise regression analysis suggested that this SNP was an independently unfavorable factor for the prognosis of NSCLC and the effect remained significant in subgroup analysis stratified by clinical parameters and treatment status. Moreover, multivariate logistic regression analysis showed that the subjects with AG/GG genotypes of rs895819 had significantly decreased response rate to platinum-based chemotherapy compared to those with the AA genotype.Conclusion: Our results suggest that the pre-miR-27a rs895819 polymorphism may influence NSCLC patients' clinical outcome. Further large sample studies should be used to validate our findings.
miR-146b-5p and miR-520h Expressions Are Upregulated in Serum of Women with Recurrent Spontaneous Abortion

Maryam Shahidi,Farzad Nazari,Hossein Ghanbarian,Robabeh Taheripanah,Mahsa Hajivalili,Davar Amani

DOI: https://doi.org/10.1007/s10528-021-10173-5

2022-01-27

Biochemical Genetics

Abstract:Unexplained recurrent spontaneous abortion (URSA) is characterized by two or more consecutive pregnancy losses before the 20th week of gestation with unknown etiology. Dysregulation of microRNAs (miRNAs) expression has been reported in reproductive diseases. This study aimed to compare differentially expressed miRNAs in the serum samples between URSA patients and healthy individuals. URSA cases were confirmed by a gynecologist. Peripheral blood sample was‏ gathered from 9 URSA patients, 15 normal pregnant, and 10 non-pregnant women without abortion history. After separating serum, the expression levels of the miR-101-3p, miR-517c-3p, miR-146b-5p, miR-221-3p, and miR-520 h were measured by qRT-PCR assay. The circulating level of miR-520 h in URSA patients was significantly up-regulated compared with healthy pregnant (P < 0.01) and healthy non-pregnant (P = 0.002) women. Furthermore, miR-520 h expression was significantly different between healthy non-pregnant and pregnant women (P = 0.002). Statistical analysis indicated miR-146b-5p expression was significantly up-regulated in URSA patients compared to normal pregnant women (P = 0.018). However, the transcription level of miR-146b-5p was insignificantly different between normal non-pregnant women and the other two groups. Also, circulating levels of miR-101-3p, miR-221-3p, and miR-517c-3p were not significantly different in the studied groups. Statistical analysis showed significant correlations between both miR-221-3p and miR-517c-3p and other miRNAs (P < 0.05). The circulating levels of miR-520 h and miR-146b-5p could be considered biomarkers for URSA diagnosis. Also, miR-517c-3p and miR-221-3p might play a regulatory role in other miRNAs expressions during pregnancy. Previous work, in contrary to our findings, claims that the expression levels of miR-221-3p, miR-101-3p, and miR-517c-3p increased in plasma and tissue samples of patients with URSA. However, our research for the first time indicates that the expression level of miR-520 h and miR-146b-5p in the serum of these patients has increased. Future investigations are necessary to confirm these findings.

genetics & heredity,biochemistry & molecular biology
Associations of Mirna Polymorphisms and Female Physiological Characteristics with Breast Cancer Risk in Chinese Population

M. Zhang,M. Jin,Y. Yu,S. Zhang,Y. Wu,H. Liu,B. Chen,Q. Li,X. Ma,K. Chen

DOI: https://doi.org/10.1111/j.1365-2354.2011.01308.x

IF: 2.1

2011-01-01

European Journal of Cancer Care

Abstract:mircoRNAs (miRNAs) play important roles on regulation of gene expressions. Aberrant expression of miRNAs was involved in various biological and pathological processes, including tumorigenesis of breast cancer. Single-nucleotide polymorphisms (SNPs) were implicated in altered expression or biological functions of mature miRNAs. To explore the relevance of miRNA polymorphisms and female physiological characteristics to breast cancer risk, SNPs located within hsa-miR-605 (rs2043556), hsa-miR-149 (rs2292832), hsa-miR-27a (rs895819), hsa-miR-196a-2 (rs11614913) and hsa-miR-618 (rs2682818) were selected, and their associations with breast cancer risk were analysed. In addition, associations between physiological characteristics-related factors and breast cancer risk were estimated too. We found that the ones with menarche age less than 16 years had increased breast cancer risk (OR = 2.10, 95% CI: 1.23-3.60). Marginally significant association between rs11614913 CT/CC genotypes and reduced breast cancer risk was observed (OR = 0.65, 95% CI: 0.40-1.06), while no significance was detected about the other miRNA polymorphisms. We concluded that menarche at less than 16 years old increased breast cancer risk, while the genetic variants in miR-196-a-2 might decrease the risk.
Association between rs1049174 NKG2D gene polymorphism and idiopathic recurrent spontaneous abortion in Iranian women: a case-control study

Amir Abdian Asl,Fereshteh Vaziri Nezamdoust,Farzaneh Fesahat,Akram Astani,Meisam Barati,Pourya Raee,Abolghasem Asadi-Saghandi

DOI: https://doi.org/10.1080/01443615.2020.1798906

2020-10-16

Journal of Obstetrics and Gynaecology

Abstract:Natural killer group 2, member D (NKG2D) is one of the best known activating receptors of NK cells, which recognises its ligand on altered or stressed cells and activates NK cells to kill them. In this study, the single nucleotide polymorphism of the NKG2D gene for rs1049174 mutation was compared in 140 women with recurrent spontaneous abortion (RSA) and 175 control women with at least one successful pregnancy and without any known pregnancy loss. The findings just revealed that GG genotype and G allele were significantly higher in the case group compared with the control group (p < .001). Our results regarding decreased risk of RSA in C allele (OR = 0.438; 95%CI = 0.310–0.619; p < .001), and GC genotype (OR = 0.492; 95%CI = 0.214–0.574; p < .001) compared with G allele and GG genotype respectively. This study demonstrated a significant association between NKG2D gene polymorphism (rs1049174 G/C) and the risk of RSA in Iranian women. What is already known on this subject? According to previous investigations, maternal immune responses may affect the foetus, causing recurrent spontaneous abortion (RSA). The main cause of RSA has not yet been detected in nearly 50% of the cases. What do the results of this study add? The results showed that the frequency of G allele and C allele were significantly different in the case group and control group. What are the implications of these findings for clinical practice and/or further research? The results suggest a protective function of C allele because it significantly decreased the risk of RSA compared to G allele. It improves inhibition of NK cells and probably participates in maintaining pregnancy in fertile controls; whereas, G allele is related to a slight inhibition of NK cells, probably leading to increase effectiveness of NK activation and undesirable inflammation, which consequently causes foetal rejection.

obstetrics & gynecology
Identification of genetic polymorphisms in unexplained recurrent spontaneous abortion based on whole exome sequencing

Jiang-Tao Mou,Shi-Xing Huang,Li-Li Yu,Jing Xu,Qiao-Ling Deng,Yi-Shan Xie,Kun Deng

DOI: https://doi.org/10.21037/atm-22-2179

IF: 3.616

2022-05-27

Annals of Translational Medicine

Abstract:Background: The precise etiology of approximately 50% of patients with recurrent spontaneous abortion (RSA) is unclear, known as unexplained recurrent spontaneous abortion (URSA). This study identified the genetic polymorphisms in patients with URSA.Methods: Genomic DNA was extracted from 30 couples with URSA and 9 couples with normal reproductive history for whole exome sequencing. Variations in annotation, filtering, and prediction of harmfulness and pathogenicity were examined. Furthermore, predictions of the effects of changes in protein structure, Sanger validation, and functional enrichment analyses were performed. The missense mutated genes with significant changes in protein function, and genes with mutations of premature stop, splice site, frameshift, and in-frame indel were selected as candidate mutated genes related to URSA.Results: In 30 unrelated couples with URSA, 50%, 20%, and 30% had 2, 3, and more than 4 miscarriages, respectively. Totally, 971 maternal and 954 paternal mutations were found to be pathogenic or possibly pathogenic after preliminary filtering. Total variations were not associated with age nor the number of miscarriages. In 28 patients (involving 23 couples), 22 pathogenic or possibly pathogenic variants of 19 genes were found to be strongly associated with URSA, with an abnormality rate of 76.67%. Among these, 12 missense variants showed obvious changes in protein functions, including ANXA5 (c.949G>C; p.G317R), APP (c.1530G>C; p.K510N), DNMT1 (c.2626G>A; p.G876R), FN1 (c.5621T>C; p.M1874T), MSH2 (c.1168G>A; p.L390F), THBS1 (c.2099A>G; p.N700S), KDR (c.2440G>A; p.D814N), POLR2B (c.406G>T; p.G136C), ITGB1 (c.655T>C; p.Y219H), PLK1 (c.1210G>T; p.A404S), COL4A2 (c.4808 A>C; p.H1603P), and LAMA4 (c.3158A>G; p.D1053G). Six other genes with mutations of premature stop, splice site, frameshift, and in-frame indel were also identified, including BUB1B (c.1648C>T; p.R550*) and MMP2 (c.1462_1464delTTC; p.F488del) from the father, and mutations from mother and/or father including BPTF (c.396_398delGGA; p.E138 del and c.429_431GGA; p.E148del), MECP2 (c.21_23delCGC; p.A7del), LAMA2 (HGVS: NA; Exon: NA; SPLICE_SITE, DONOR), and SOX21 (c.640 _641insT; p. A214fs, c.644dupC; p. A215fs and c.644_645ins ACGCGTCTTCTTCCCGCAGTC; p. A215dup).Conclusions: These pathogenic or potentially pathogenic mutated genes may be potential biomarkers for URSA and may play an auxiliary role in the treatment of URSA.

oncology,medicine, research & experimental
Evaluation of homocysteine, folic acid and methylenetetrahydrofolate reductase C677T gene polymorphism associated with recurrent spontaneous miscarriage

Abdul-Hussein Moyet,Rasha Abdull-Hussein Mahood,Saad Mohamed Nada

DOI: https://doi.org/10.31185/jwsm.263

2022-12-09

Abstract:This study was aimed to assess the association between evaluation of homocysteine level, folic acid and methylenetetrahydrofolate reductase MTHFR C677T gene polymorphism and recurrent pregnancy loss RSA. Sixty four women diagnosed with RSA and 41 normal fertile female, who had at least one or more child, 21 of them were pregnant women while 20 were non-pregnant. The level of homocysteine was high in women with RSA (11.41+3.75) (p<0.05) compared to normal fertile women either pregnant (7.02+2.13) or non-pregnant (6.84+2.08), low levels of folic acid was observed (6.35+2.09) in women with RSA (p<0.05) compared to fertile women either pregnant(10.08+3.08) or non-pregnant(11.27+3.15). No statistically significant difference was observed in the distribution of genotypes between cases and controls for MTHFR polymorphism. In conclusion, the present study reveals to lack of association of MTHFR C677T polymorphism in RSA women.
Interactive Effects of Snps Located Within CD28/B7Pathway and Environment on Susceptibility to Recurrent Spontaneous Abortion

Guiling Wang,Jing Sun

DOI: https://doi.org/10.1159/000484297

Abstract:Aims: This study was aimed to explore the interaction between environment and CD28/B7 pathway to provide the potential epidemiology for prevention and treatment of recurrent spontaneous abortion (RSA). Methods: The retrospective study included 630 RSA cases and 1320 healthy women during their middle and late prenatal care. Their living environment was investigated, and the influence of environmental factors on pregnancy abortion was analyzed. The genomic DNAs were extracted from the study subjects, and the polymorphisms of CD28 and B7 were analyzed. Finally, the interaction of gene and environment on RSA was analyzed with the logistic regression analyses. Results: The multi-variate regression analysis indicated that vitamin supplement, intake of fresh fruits or vegetables, night shift, staying up late, history miscarriage, as well as history induced abortion were, independently, risk factors for RSA (all P< 0.05). Moreover, rs3116496 (T>C), rs3181098 (G>A) and rs3181100 (G>C) of CD28, rs1915087 (C>T) of B7-2, as well as rs6804441 (A>G) and rs41271391 (G>T) of B7-1 were correlated with modified RSA risk (all P< 0.05). The haplotypes TGT and TAG could also regulate the risk of RSA (both P< 0.05). The synthetic influences of the aforementioned SNPs and environmental factors could also significantly affect the susceptibility to RSA (all P< 0.05). Conclusion: The interaction of environment and SNPs of CD28/B7 pathway on RSA risk was distinct from CD28/B7 pathway or environment alone.
[Chromosomes and fertility: a cytogenetic study of sterile couples and couples presenting repeated early abortions (author's transl)].

J. Pernod,C. Soubirous,J. Robert

1975-02-09

Abstract:
Correlation of TGF-β signaling pathway gene polymorphisms with unexplained recurrent spontaneous abortion

Huiqin Xue,Jinsong Jiang,Jingbo Gao,Min Guo,Qiaoyin Tang,Xinyan Li,Hongyong Lu,Xiayu Sun,Jianrui Wu,Yuping Zhang

DOI: https://doi.org/10.1097/md.0000000000035697

IF: 1.6

2024-02-10

Medicine

Abstract:Recurrent spontaneous abortion (RSA), is defined as three or more consecutive pregnancy losses before the fetal weight of 500 g or lower. [ 1 ] This criterion was changed internationally to two or more consecutive spontaneous abortions before 20 weeks of gestation. [ 2 ] The incidence of RSA is 5% of all pregnancies in China and abroad. [ 3 ] The risk factors for RSA are mainly chromosomal abnormalities, thrombosis, infection, immune dysfunction, endocrine disorders, and uterine abnormalities, but unexplained RSA (URSA) still accounts for about 50% of all RSA women. [ 4 ] Therefore, it is important to study the pathogenesis of URSA to eventually cure or prevent RSA in advance.

medicine, general & internal
The Association between Histidine-Rich Glycoprotein rs10770 Genotype and Recurrent Miscarriage in Iranian Women

Mahbobeh Latifimehr,Leila Nazari,Ali Asghar Rastegari,Zahra Zamani,Pezhman Fard-Esfahani

DOI: https://doi.org/10.1155/2024/2501086

2024-04-17

Abstract:Purpose: Recurrent miscarriage (RM) is a significant reproductive concern affecting numerous women globally. Genetic factors are believed to play a crucial role in RM, making the histidine-rich glycoprotein (HRG) gene, a topic of interest due to its potential involvement in angiogenesis. This study is aimed at investigating the association between the HRG rs10770 genotype and RM. Method: Blood samples were collected from a total of 200 women at the beginning of the study. Subsequently, a comparative analysis was conducted between the blood samples of 100 women with a history of RM (case group) and the blood samples of another 100 healthy women (control group). HRG rs10770 genotyping was performed through polymerase chain reaction restriction-fragment length polymorphism (PCR-RFLP), followed by statistical analysis to evaluate the relationship between HRG rs10770 genotype and RM. Results: The results indicated a significant statistical difference between the C/C genotype (OR = 3.32, CI: 1.22-9.04, p = 0.01) and the C/T genotype (OR = 1.24, CI: 0.67-2.30, p = 0.47) in both the case and control groups. Additionally, a significant correlation was observed in the C allelic frequency among RM participants compared to the control group (OR = 1.65, CI: 1.06-2.58, p = 0.02). Conclusion: The study highlights the importance of HRG rs10770 in understanding RM, shedding light on its implications for reproductive health. Furthermore, it became evident that women carrying the homozygous C/C genotype exhibited increased susceptibility to the risk of RM.
Polymorphisms in Microrna Target Sites Influence Susceptibility to Schizophrenia by Altering the Binding of Mirnas to Their Targets

Yunguo Gong,Chao N. Wu,Jiawei Xu,Guoyin Feng,Q. H. Xing,W. Fu,Chong Li,L. He,X. Z. Zhao

DOI: https://doi.org/10.1016/j.euroneuro.2012.12.002

IF: 5.415

2013-01-01

European Neuropsychopharmacology

Abstract:Single nucleotide polymorphisms (SNPs) in 3' untranslated regions (3' UTRs) of genes may affect miRNA binding to messenger RNA and contribute to the risk of disease. Whether the SNPs that modify miRNA binding in the 3' UTR are involved in schizophrenia-related genes remains unclear. We selected 803 SNPs from the 3' UTRs of 425 candidate genes for schizophrenia. The potential target SNPs were recognized by Gibbs free energy of miRNA binding. Some SNPs were associated in the literature with schizophrenia or other related neurological diseases. A case-control study of nine SNPs not previously reported as significant in any disease was carried out in a Chinese-Han cohort. We found that rs3219151 (C>T, GABRA6) showed significant decreased risk for schizophrenia (OR=0.8121, p=0.008, p(adjust)=0.03). Further, two putative target SNPs, rs165599 (COMT) and rs10759 (RGS4) reported in several references previously, were selected for analysis by luciferase assay to determine their modification to miRNA binding. We found that miR-124 showed significantly repressed 3' UTR binding to RGS4 mRNA from the rs10759-C allele (p<0.05). Our results suggest that rs3219151 of GABRA6 was associated significantly to decrease the risk of schizophrenia, rs10759 (RGS4) was possible to increase the risk of schizophrenia by miRNA altering the binding of miRNAs to their targets influencing susceptibility to schizophrenia.

An Introduction to the Papers Presented at the NICHD Conference on Prevention of Bilirubin-Induced Brain Injury and Kernicterus

Association of microRNA gene polymorphisms with recurrent spontaneous abortion: An updated meta‑analysis

[Relationship between IL-18 gene polymorphism and unexplained recurrent spontaneous abortion].

Association of miR-146a and miR196a2 genotype with susceptibility to idiopathic recurrent pregnancy loss in Iranian women: A case-control study

Association of miR-146a rs2910164 and miR-499 rs3746444 polymorphisms with risk of ischemic stroke

Relationship Between Cytokine Gene Polymorphisms and Recurrent Spontaneous Abortion.

Gut Microbiota-Derived Metabolites Associate with Circulating Immune Cell Subsets in Unexplained Recurrent Spontaneous Abortion

miR-27a and miR-449b polymorphisms associated with a risk of idiopathic recurrent pregnancy loss

Meta-analysis of FOXP3 polymorphisms and recurrent spontaneous abortion susceptibility

Genome-wide miRNA profiling of villus and decidua of recurrent spontaneous abortion patients.

A Genetic Polymorphism In Pre-Mir-27a Confers Clinical Outcome Of Non-Small Cell Lung Cancer In A Chinese Population

miR-146b-5p and miR-520h Expressions Are Upregulated in Serum of Women with Recurrent Spontaneous Abortion

Associations of Mirna Polymorphisms and Female Physiological Characteristics with Breast Cancer Risk in Chinese Population

Association between rs1049174 NKG2D gene polymorphism and idiopathic recurrent spontaneous abortion in Iranian women: a case-control study

Identification of genetic polymorphisms in unexplained recurrent spontaneous abortion based on whole exome sequencing

Evaluation of homocysteine, folic acid and methylenetetrahydrofolate reductase C677T gene polymorphism associated with recurrent spontaneous miscarriage

Interactive Effects of Snps Located Within CD28/B7Pathway and Environment on Susceptibility to Recurrent Spontaneous Abortion

[Chromosomes and fertility: a cytogenetic study of sterile couples and couples presenting repeated early abortions (author's transl)].

Correlation of TGF-β signaling pathway gene polymorphisms with unexplained recurrent spontaneous abortion

The Association between Histidine-Rich Glycoprotein rs10770 Genotype and Recurrent Miscarriage in Iranian Women

Polymorphisms in Microrna Target Sites Influence Susceptibility to Schizophrenia by Altering the Binding of Mirnas to Their Targets