cDNA microarrays for pharmacogenomic analysis of cystic fibrosis.

M. Srivastava,O. Eidelman,H. Pollard

DOI: https://doi.org/10.1385/1-59259-187-6:21

Abstract:

What problem does this paper attempt to address?

Case Report: Laboratory detection of a thrombotic tendency in a family with hypodysfibrinogenemia and a novel FGG mutation

Amaury Monard,Elisabetta Castoldi,Ilaria De Simone,Kanin Wichapong,Tirsa van Duijl,Maartje van den Biggelaar,Stefano Spada,William van Doorn,Dave Hellenbrand,Paola van der Meijden,Frauke Swieringa,Alexander Stork,Hugo ten Cate,Erik Beckers,Floor Heubel-Moenen,Yvonne Henskens

DOI: https://doi.org/10.3389/fcvm.2024.1488602

IF: 3.6

2024-10-16

Frontiers in Cardiovascular Medicine

Abstract:Introduction: Hypodysfibrinogenemia is a rare congenital fibrinogen disorder (CFD) which may induce thrombotic and bleeding events. Therefore, patient management needs careful evaluation. Routine coagulation tests are inadequate to predict the clinical phenotype. Clinical findings: A 60-year-old woman with both bleeding and thrombotic complications and her two daughters were referred to our center for genotypic and phenotypic analysis of a CFD. Diagnosis: Conventional laboratory results led to the diagnosis of hypodysfibrinogenemia in all three subjects. They all carried the same heterozygous c.1124A>G mutation in FGG resulting in p.Tyr375Cys amino acid substitution, which was confirmed by protein variant analysis from plasma. In silico structure analysis predicted possible conformational and functional changes of the fibrinogen molecule. Thrombin generation indicated a hypercoagulable state confirmed by microfluidics that showed enhanced fibrin formation in both daughters, regardless of the coagulation trigger. Conclusion: We report on a family with hypodysfibrinogenemia and a novel FGG heterozygous missense mutation, possibly leading to conformational changes or covalent dimerization. Thrombin generation and particularly microfluidic measurements disclosed a hypercoagulable state, which was not detected with routine coagulation tests, justifying a different patient management.

cardiac & cardiovascular systems
Voice dysfunction in dysarthria: application of the Multi-Dimensional Voice Program.

Raymond D. Kent,H. K. Vorperian,J. F. Kent,J. Duffy

DOI: https://doi.org/10.1016/S0021-9924(03)00016-9

IF: 1.864

2003-07-01

Journal of Communication Disorders

Abstract:
Congenital Fibrinogen Disorders with Repeated Thrombosis

Xiuli Zhang,Chuang Zhang,Baoheng Wang,Ningheng Chen,Gaihe Sun,Xueli Guo

DOI: https://doi.org/10.1007/s11239-019-01958-y

2019-01-01

Journal of Thrombosis and Thrombolysis

Abstract:Congenital dysfibrinogenemia is characterized with undetectable or low fibrinogen level by Clauss assay complicated by bleeding and/or thrombosis. These may lead to a diagnostic problem to some clinicians unfamiliar with this disease. We reported a case of congenital dysfibrinogenemia manifested as hemorrhage, repeated thrombosis, low fibrinogen levels through Clauss assay and but normal levels of fibrinogen through PT-derived tests. In conclusion, to patients with thrombosis complicated by decreased fibrinogen level, clinicians and laboratory physicians should be alert to the possibility of congenital dysfibrinogenemia.
[Small Maf proteins as transcription factors regulating maturation and maintenance of the cell].

H. Motohashi

2003-09-01

Seikagaku. The Journal of Japanese Biochemical Society

Abstract:
Congenital fibrinogen disorders: a retrospective clinical and genetic analysis of the Prospective Rare Bleeding Disorders Database

Samin Mohsenian,Roberta Palla,Marzia Menegatti,Andrea Cairo,Anna Lecchi,Alessandro Casini,Marguerite Neerman-Arbez,Rosanna Asselta,Sara Scardo,Simona Maria Siboni,Jan Blatny,Ondrej Zapletal,Jean-Francois Schved,Muriel Giansily-Blaizot,Susan Halimeh,Mohamad Ayman Daoud,Helen Platokouki,Helen Pergantou,Roger E G Schutgens,Monique Van Haaften-Spoor,Paul Brons,Britta Laros-van Gorkom,Elise Van Pinxten,Munira Borhany,Naveena Fatima,Danijela Mikovic,Marko Saracevic,Gül Nihal Özdemir,Yılmaz Ay,Michael Makris,Caryl Lockley,Andrew Mumford,Andrew Harvey,Steve Austin,Amy Shapiro,Adrianna Williamson,Catherine McGuinn,Ilene Goldberg,Philippe De Moerloose,Flora Peyvandi,Jan Blatný,Ayman Daoud,Roger E.G. Schutgens,Britta A.P. Laros-van Gorkom,Andrew D. Mumford,Steven Kenneth Austin,Amy D. Shapiro,Philippe de Moerloose

DOI: https://doi.org/10.1182/bloodadvances.2023012186

IF: 7.642

2024-01-29

Blood Advances

Abstract:Congenital fibrinogen deficiency (CFD) is a rare bleeding disorder caused by mutations in FGA, FGB and FGG. We sought to comprehensively characterize patients with CFD using PRO-RBDD (Prospective Rare Bleeding Disorders Database). Clinical phenotypes, laboratory and genetic features were investigated using retrospective data from the PRO-RBDD. Patients were classified from asymptomatic to grade III based on their bleeding severity. In addition, FGA, FGB and FGG were sequenced to find causative variants. A total of 166 CFD cases from 16 countries were included, of whom 123 (30 afibrinogenemia, 33 hypofibrinogenemia, 55 dysfibrinogenemia, 5 hypodysfibrinogenemia) were well characterized. Considering the previously established factor activity and antigen level thresholds, bleeding severity was correctly identified in 58% of cases. The rate of thrombotic events among afibrinogenemic and hypofibrinogenemic patients were relatively similar (11% and 10%) and surprisingly higher than in dysfibrinogenemic cases. The rate of spontaneous abortions among 68 pregnancies was 31%, including 86% in dysfibrinogenemic women and 14% with hypofibrinogenemia. 86 patients received treatment (69 on-demand and/or 17 on prophylaxis), fibrinogen concentrates being the most frequently used product. Genetic analysis was available for 91 cases and 41 distinct variants were identified. Hotspot variants (FGG, p.Arg301Cys/His and FGA, p.Arg35Cys/His) were present in 51% of dysfibrinogenemia. Obstetric complications were commonly observed in dysfibrinogenemia. This large multicenter study provided a comprehensive insight into the clinical, laboratory and genetics of patients with CFDs. We conclude that bleeding severity grades were in agreement with the established factor activity threshold in nearly half of the cases with quantitative defects.

hematology
Clinical, Laboratory, and Molecular Aspects of Congenital Fibrinogen Disorders

Alessandro Casini,Philippe de Moerloose,Marguerite Neerman-Arbez

DOI: https://doi.org/10.1055/s-0044-1788898

2024-08-18

Seminars in Thrombosis and Hemostasis

Abstract:Congenital fibrinogen disorders (CFDs) include afibrinogenemia, hypofibrinogenemia, dysfibrinogenemia, and hypodysfibrinogenemia. The fibrinogen levels, the clinical features, and the genotype define several sub-types, each with specific biological and clinical issues. The diagnosis of CFDs is based on the measurement of activity and antigen fibrinogen levels as well as on the genotype. While relatively easy in quantitative fibrinogen disorders, the diagnosis can be more challenging in qualitative fibrinogen disorders depending on the reagents and methods used, and the underlying fibrinogen variants. Overall, quantitative and qualitative fibrinogen defects lead to a decrease in clottability, and usually in a bleeding tendency. The severity of the bleeding phenotype is moreover related to the concentration of fibrinogen. Paradoxically, patients with CFDs are also at risk of thrombotic events. The impact of the causative mutation on the structure and the fibrinogen level is one of the determinants of the thrombotic profile. Given the major role of fibrinogen in pregnancy, women with CFDs are particularly at risk of obstetrical adverse outcomes. The study of the fibrin clot properties can help to define the impact of fibrinogen disorders on the fibrin network. The development of next generation sequencing now allows the identification of genetic modifiers able to influence the global hemostasis balance in CFDs. Their integration in the assessment of the patient risk on an individual scale is an important step toward precision medicine in patients with such a heterogeneous clinical course. Article published online: 16 August 2024 © 2024. Thieme. All rights reserved. Thieme Medical Publishers, Inc. 333 Seventh Avenue, 18th Floor, New York, NY 10001, USA

peripheral vascular disease,hematology
Inherited Disorders of the Fibrinolytic Pathway: Pathogenic Phenotypes and Diagnostic Considerations of Extremely Rare Disorders

Maha Al-Ghafry,Mouhamed Yazan Abou-Ismail,Suchitra S. Acharya

DOI: https://doi.org/10.1055/s-0044-1789596

2024-09-21

Seminars in Thrombosis and Hemostasis

Abstract:Fibrinolysis is initiated by the activation of plasminogen to plasmin via tissue-plasminogen activator (tPA) and urokinase-plasminogen activator (uPA); plasmin then converts fibrin to fibrin degradation products (FDPs). The antifibrinolytics counterbalancing this system include plasminogen activator inhibitor-1 (PAI-1), which inhibits tPA and uPA, α-2 antiplasmin (α 2 AP), which inhibits plasmin, and thrombin activatable fibrinolysis inhibitor, which inhibits the conversion of fibrin to FDP. Inherited disorders of the fibrinolytic pathway are rare and primarily have hemorrhagic phenotypes in humans: PAI-1 deficiency, α 2 AP deficiency, and Quebec platelet disorder. Patients with these disorders are usually treated for bleeds or receive prophylaxis to prevent bleeds in the surgical setting, with pharmacological antifibrinolytics such as aminocaproic acid and tranexamic acid. Disorders of the fibrinolytic pathway with fibrin deposition are extremely rare, mostly noted in patients with plasminogen deficiency, who have more recently benefited from advances in human plasma-derived plasminogen concentrates administered intravenously or locally. These disorders can be very difficult to diagnose using conventional or even specialized coagulation testing, as testing can be nonspecific or have low sensitivity. Testing of the corresponding protein's activity and antigen (where applicable) can be obtained in specialized centres, and routine laboratory measures are not diagnostic. Genetic testing of the pathogenic mutations is recommended in patients with a high suspicion of an inherited disorder of the fibrinolytic pathway. Article published online: 19 September 2024 © 2024. Thieme. All rights reserved. Thieme Medical Publishers, Inc. 333 Seventh Avenue, 18th Floor, New York, NY 10001, USA

peripheral vascular disease,hematology
A novel γ-chain mutation p.Asp318His in a Chinese family with dysfibrinogenemia

Haiyue Zhang,Weifeng Shen

DOI: https://doi.org/10.1097/mbc.0000000000001329

2024-11-13

Blood Coagulation & Fibrinolysis

Abstract:Congenital dysfibrinogenemia is characterized by reduced fibrinogen activity, but normal immunoreactive fibrinogen levels. Here, we present a novel case with an elevated risk of thrombosis.

hematology
The FGG c.952G>A variant causes congenital dysfibrinogenemia characterized by recurrent cerebral infarction: a case report

Anna Ying,Yuanlin Zhou,Chunyue Wang,Tao Wang,Xuan Zhang,Shanshan Wang,Shaofa Ke,Yuyan Bao,Yang Liu,Feng Wang

DOI: https://doi.org/10.3389/fneur.2024.1272802

IF: 3.4

2024-01-25

Frontiers in Neurology

Abstract:Background: Congenital dysfibrinogenemia (CD) is a rare hereditary coagulation disorder resulting from mutations in fibrinogen genes. CD primarily presents with bleeding symptoms, but it can also lead to thrombotic events, including ischemic stroke. Case presentation: This report describes the case of a 52-year-old Chinese man who was admitted to the hospital twice due to recurrent cerebral infarction, characterized by sudden speech impairment and weakness in the right upper extremity. Brain MRI revealed multiple ischemic changes, predominantly in the left frontal and parietal lobes. Coagulation tests demonstrated reduced plasma fibrinogen (Clauss method), prolonged prothrombin time and thrombin time, and an elevated international normalized ratio. However, the ELISA assay indicated elevated levels of fibrinogen γ-chain protein. Despite a 2-month-old treatment regimen with aspirin, clopidogrel, and atorvastatin after the first hospitalization, the patient experienced a second ischemic stroke. Genetic analysis using whole-exome sequencing (WES) and Sanger sequencing identified a rare heterozygous missense variation, FGG c.952G>A (rs267606810), in both the stroke patient and his asymptomatic sister. Both individuals exhibited the same alterations in fibrinogen, characterized by reduced functional levels but increased antigenic protein. Subsequently, the patient was diagnosed with ischemic stroke associated with congenital dysfibrinogenemia. Conclusion: This case report expands the clinical phenotype spectrum associated with FGG c.952G>A (rs267606810) and underscores the significance of considering CD as a potential etiology for unexplained ischemic stroke, particularly in patients with a family history of coagulation disorders.

neurosciences,clinical neurology
Factor V haemostatic diathesis impairing thrombin activation, membrane binding and circulating antigen level due to a novel compound heterozygous mutation, Leu1821Ser and Gly2192Cys

Kimberley Talbot,Jina Song,John R Perrier,Shannon Jackson,Ross T A MacGillivray,Edward L G Pryzdial

DOI: https://doi.org/10.1111/hae.15087

2024-08-08

Haemophilia

Abstract:Introduction: Congenital factor V (FV) deficiency is a rare clotting disorder affecting ∼1 in 1,000,000, with bleeding severity that ranges broadly for poorly understood reasons. Aim: To help understand the molecular basis of the observed phenotype in FV deficient patients, the genetics and biochemistry causing a patient's FV deficiency were evaluated. Methods and results: A 71-year-old female, who had serious life-long bleeding upon provocation and profound menorrhagia that lead to hysterectomy, was found to have 3% of normal plasma FV antigen with normal electrophoretic mobility. Platelet FV was similarly low, although the banding pattern was less fragmented than normal. Plasma clotting activity was <1% of normal. Familial inheritance and DNA sequence analysis from peripheral blood leukocytes were consistent with novel compound heterozygosity with missense mutations in exon XVII, Leu1821 to Ser (L1821S) and exon XXV, Gly2192 to Cys (G2192C). The respective single-mutation variants were expressed and purified. Explaining why the antigen level and activity were inequivalent, thrombin activation of recombinant (r) FV/L1821S was impaired, and rFV/G2192C was unable to bind to a procoagulant phospholipid membrane. Conclusion: These findings are consistent with the observed phenotype, highlighting the importance of understanding FV biochemical function to rationalize clinical bleeding severity when the circulating antigen level is discordant.
A novel fibrinogen γ-chain frameshift mutation, p. Cys365Phefs*41, causing hypofibrinogenemia with bleeding phenotype in a Chinese family

Weijie Zhou,Yan Huang,Jie Wei,Jun Li Wang,Boming Huang,Xiaoxuan Zhou,Jie Yan,Yangyang Wu,Faquan Lin,Wangrong Wen

DOI: https://doi.org/10.21037/atm-21-3207

IF: 3.616

2021-08-01

Annals of Translational Medicine

Abstract:BACKGROUND: Congenital hypofibrinogenemia is a rare bleeding disease that is classified as the quantitative deficient type. In the present study, investigated the relationship between the genotype and phenotype in a family with hypofibrinogenemia.METHODS: The proband was aware of a predisposition to bleeding. Functional analysis was performed for her all family members, including coagulation function tests, thrombus molecular markers, thromboelastography, scanning electron microscopy, DNA sequencing, and high-performance liquid chromatography-mass spectrometry (HPLC-MS). Pathogenicity analysis and protein modeling of mutant amino acids were also performed.RESULTS: A novel heterozygous mutation in c.1094delG was detected in FGG exon 8, which resulted in p. Cys365Phefs*41 (containing the signal peptide) in the proband and her mother, who showed a corresponding decrease in fibrinogen function and levels. Thromboelastography indicated that the strength of their blood clots decreased and they had an increased risk of bleeding. The proband fibrin network structure was looser than healthy controls, with large pores in the network, which increased the permeability of lytic enzymes. Results of HPLC-MS showed a lack of mutant peptide chain expression in their plasma, indicating that the family had congenital hypofibrinogenemia, with a clinical phenotype that is related to the degree of fibrinogen deficiency. The mutation truncated the γ-peptide chain and destroyed the functional structure of fibrinogen, including the γ352Cys-γ365Cys disulfide bond. The truncated peptide chains may also lead to nonsense-mediated decay.CONCLUSIONS: The mutation induced a structural change at the carboxyl-terminal of the fibrinogen molecule, leading to fibrinogen secretion dysfunction.

oncology,medicine, research & experimental
Hyperfibrinolysis: a crucial phenotypic abnormality of posttraumatic fibrinolytic dysfunction

Kyosuke Takahashi,Kazuma Yamakawa,Anaar E Siletz,Morihiro Katsura,John B Holcomb,Charles E Wade,Jessica C Cardenas,Erin E Fox,Morgan Schellenberg,Matthew Martin,Kenji Inaba,Kazuhide Matsushima

DOI: https://doi.org/10.1016/j.rpth.2024.102568

2024-09-11

Abstract:Background: Traumatic fibrinolytic dysfunction is often categorized into 3 phenotypes based on the result of thromboelastography (TEG) lysis at 30 minutes (LY30): fibrinolysis shutdown, physiologic fibrinolysis, and hyperfibrinolysis. However, the molecular pathophysiology of fibrinolytic dysfunction and the association with clinical outcomes have not been fully evaluated. Objectives: To assess whether posttraumatic fibrinolysis phenotypes identified by TEG correlate with levels of key fibrinolysis-related serum markers and with risk of mortality and hospital complications. Methods: This is a secondary analysis of the Pragmatic, Randomized Optimal Platelet and Plasma Ratios trial. Patients were stratified according to the degree of fibrinolysis upon arrival using TEG LY30 values: low LY30, <0.8%; normal LY30, 0.81% to 0.9%; and high LY30, ≥3%. Serial values of molecular markers (0-72 hours after admission) and clinical outcomes were compared between fibrinolysis groups. Results: A total of 547 patients were included (low LY30, 320; normal LY30, 108; high LY30, 119). The high LY30 group had higher tissue plasminogen activator and plasmin-antiplasmin values upon hospital arrival than the low LY30 or normal LY30 groups (P < .001, respectively). There was no significant difference in levels of tissue plasminogen activator, plasmin-antiplasmin, and plasminogen activator inhibitor 1 between the low LY30 and normal LY30 groups. The high LY30 group was associated with an increased risk of 24-hour and 30-day mortality, while there was no significant difference in mortality between the low LY30 and normal LY30 groups. Conclusion: Our results suggest that hyperfibrinolysis is the most common form of traumatic fibrinolytic dysfunction and is associated with worse outcome.
Human Fibrinogen: Molecular and Genetic Aspects of Congenital Disorders

Giovanni Luca Tiscia,Maurizio Margaglione,Giovanni Tiscia

DOI: https://doi.org/10.3390/ijms19061597

IF: 5.6

2018-05-29

International Journal of Molecular Sciences

Abstract:Congenital fibrinogen disorders can be quantitative (afibrinogenemia, hypofibrinogenemia) or functional (dysfibrinognemia). To date, several genetic variants have been identified in individuals with fibrinogen disorders. The complexity of the fibrinogen molecules, formed by three non-identical chains and with a trinodal organization, renders the identification of molecular causes and of clinical and biochemical phenotypes very challenging. However, the acknowledgement of the type of molecular defect is crucial for a safer therapy, which is going to improve the clinical management of these patients. In this review, some aspects concerning molecular and clinical findings available on congenital fibrinogen disorders will be discussed.

biochemistry & molecular biology,chemistry, multidisciplinary
Real world management of individuals with severe FXI deficiency and its impact on clinical outcomes: Experience from a haemophilia treatment centre

S Julia Wu,Nicholas J Cacciola-Price,Ilene Goldberg,Maria T DeSancho

DOI: https://doi.org/10.1111/hae.15075

Haemophilia

Abstract:Introduction: The management of Factor XI deficiency is challenged by a variable association between FXI level and bleeding phenotype. Additionally, there is scarce data describing management strategies and their outcomes, specifically bleeding, thrombosis, and other complications. Aims: To evaluate bleeding, thrombosis, and other complications in individuals with severe FXI deficiency seen in our comprehensive haemophilia treatment centre (HTC). Peri-procedural management strategies and the resulting impact on bleeding and other clinically relevant outcomes were reported. Methods: Retrospective review of the electronic medical record of adult patients with severe FXI deficiency (< 20% activity) seen at a New York City comprehensive HTC between 2017 and 2022. Procedures, haemostatic management, and outcomes were collected and analysed. Results: We identified 38 individuals (64%) females with severe FXI deficiency. The mean age was 56 ± 21 years (SD). The median FXI activity level was 3% (IQR: 1-8%). The mean BAT score was 3.1 ± 2.4; (52%) individuals did not have a history of bleeding. A total of 256 surgeries and procedures were performed. There was reduced bleeding with preventative or reactive treatment during procedures. Arterial but not venous thrombotic complications were observed. Plasma was mostly used for procedures associated with higher risk of bleeding and antifibrinolytics for procedures at sites of high fibrinolysis. Conclusions: Current management strategies pose a burden of care for these patients and manifested as nonbleeding adverse events and changes in clinical management. These findings highlight the need for novel investigation in predicting and managing bleeding for individuals with severe FXI deficiency.
Elevated furin expression in aggressive human head and neck tumors and tumor cell lines

D. Bassi,H. Mahloogi,L. Al-Saleem,R. López de Cicco,J. Ridge,Andres J Klein-Szanto

DOI: https://doi.org/10.1002/mc.1057

2001-08-01

Molecular Carcinogenesis

Abstract:Pro‐protein convertases (PCs) are proteases that recognize and cleave precursor proteins. Furin, a well‐studied PC, is ubiquitously expressed, and it has been implicated in many physiological and pathological processes. Some substrates for furin, such as membrane type 1 (MT1) matrix metalloproteinase (MMP), an MMP that activates gelatinase, a collagen‐degrading enzyme, are associated with the advanced malignant phenotype. This report examines the expression of furin in carcinoma cell lines of different invasive ability. The levels of furin mRNA and protein correlated with the aggressiveness of tumor cell lines derived from head and neck and lung cancers. Furin expression also was investigated in primary head and neck squamous cell carcinomas (HNSCCs). Furin mRNA was not detected in nonmetastasizing carcinomas. In contrast, furin mRNA was expressed in metastasizing HNSCCs. Immunohistochemistry and Western blot analysis confirmed these results at the protein level. Furin activity was investigated indirectly by evaluating the expression of the pro‐form and the processed form of MT1‐MMP. Metastasizing HNSCCs showed increased expression of MT1‐MMP. Furthermore, pro‐MT1‐MMP expression was noted in most of the nonmetastasizing HNSCCs analyzed by Western blot, and it was absent in the metastasizing HNSCCs. This finding suggests a lower level of furin‐mediated MT1‐MMP activation in the less aggressive cancers. These observations indicate that furin plays a role in tumor progression. Its overexpression in more aggressive or metastasizing cancers resulted in increased MMP processing. © 2001 Wiley‐Liss, Inc.
Severe haemorrhagic diathesis due to acquired hypofibrinogenemia in a patient with early T-cell precursor acute lymphoblastic leukaemia/lymphoma: a case report

Luca Spiezia,Marcello Riva,Carmela Gurrieri,Elena Campello,Paolo Simioni

DOI: https://doi.org/10.3389/fcvm.2023.1335296

IF: 3.6

2024-01-08

Frontiers in Cardiovascular Medicine

Abstract:The most frequent haematological malignancy associated with acquired hypo/dysfibrinogenemia is multiple myeloma. We present an unusual case of severe haemorrhagic diathesis due to acquired hypofibrinogenemia in a patient with early T-cell precursor acute lymphoblastic leukaemia/lymphoma (ETP-ALL/LBL). A 57-year-old male was admitted to the General Internal Medicine Department of Padova University Hospital for acute massive haematomas of the left lower extremity associated with macrohaematuria. Coagulation tests showed prolonged prothrombin time, activated partial thromboplastin time and thrombin time due to isolated severe hypofibrinogenemia (antigen 0.70 g/L and activity 26%). The radiological workup showed a bulky lesion located in the anterior mediastinum, and a biopsy led to the diagnosis of ETP-ALL/LBL. Fibrinogen replacement therapy failed to correct the bleeding diathesis and we were able to exclude other frequent causes of acquired hypofibrinogenemia (i.e., liver dysfunction, fibrinogen-specific antibody or drug toxicity); therefore, we hypothesised that hypofibrinogenemia might stem either from enhanced removal of fibrinogen from the circulation or consumptive coagulopathy. Notably, only after initiating a specific chemotherapy treatment did the patient start showing improvement in bleeding symptoms and achieve normal fibrinogen levels.

cardiac & cardiovascular systems
[Acute arterial thrombosis in a context of hyperhomocysteinemia: Case report and literature review]

G Raybaud,M Lambert,C Douillard,A F Dessein,S Morell-Dubois,M Guillou,S Haulon,P-Y Hatron

DOI: https://doi.org/10.1016/j.revmed.2016.10.003

Abstract:Introduction: Hyperhomocysteinemia is a biological marker that could be identified in the venous thrombotic events and rarely during acute arterial thrombotic events. The consequences can be serious. Effective diagnostic strategy is needed to optimize the management. Case report: Following bariatric surgery, a 40-year-old patient was admitted with an acute encephalopathy associated with peripheral lower limb arterial ischemia. The diagnostic work-up identified a major hyperhomocysteinemia whose causes were several. Surgical treatment and anticoagulation was associated with vitamins and trace elements supplementation. Correcting deficiencies allowed delirium and hyperhomocysteinemia improvement. Once treatment established, the patient did not present a recurrent thrombotic episode. Conclusion: Major hyperhomocysteinemia seems to be associated with an increased risk of acute arterial thrombosis. This marker might be considered in nutritional deficiency situations with appropriate support on the vascular, metabolic and nutrition level.
A novel fibrinogen variant: dysfibrinogenemia associated with γAsp185Asn substitution

Na Zhou,Peipei Xu,Min Zhou,Yong Xu,Ping Li,Bin Chen,Jian Ouyang,Rongfu Zhou

DOI: https://doi.org/10.1007/s11239-017-1496-y

2017-01-01

Journal of Thrombosis and Thrombolysis

Abstract:To identify the pathogenesis of a Chinese woman diagnosed with dysfibrinogenemia. A patient from Nanjing presented with a low plasma concentration of fibrinogen and a normal level of antigen of fibrinogen. This abnormality was also detected in her son. To detect whether the genetic mutation was responsible for the dysfibrinogenemia, genomic DNA was extracted and amplified by polymerase chain reaction, and DNA sequencing was performed on the purified PCR products. Restriction fragment length polymorphism (RFLP), molecular modeling and homologous sequences alignment were performed. Two heterozygous missense variants, AαArg16His and γAsp185Asn, were discovered in the proband. Only the former was detected in her son. AαArg16His had been reported by other teams, and γAsp185Asn was identified first in our study as a novel variant. RFLP was performed and indicated that the novel failed to be found in normal subjects. Furthermore, it was suggested to be responsible for dysfibrinogenemia depending on the molecular modeling and homologous sequence alignment. The heterozygous AαArg16His and γAsp185Asn identified in the study probably underlie the dysfibrinogenemia in this pedigree, with the latter being identified for the first time.
Inherited antithrombin deficiency caused by a mutation in the SERPINC1 gene: A case report

Xinwei Hou,Kairu Zhang,Qian Wu,Mingyuan Zhang,Li Li,Hongwei Li

DOI: https://doi.org/10.1097/MD.0000000000031240

2022-11-04

Abstract:Rationale: Inherited antithrombin deficiency (ATD) is a major cause of thrombotic deficiency. Genetic testing is of great value in the diagnosis of hereditary thrombophilia. Herein, we report a case of inherited ATD admitted to our hospital. We include the results of genealogy and discuss the significance of genetic testing in high-risk groups of hereditary thrombophilia. Patient concerns: A 16-year-old male patient presented with chest tightness, shortness of breath, wheezing, and intermittent fever (up to 39 °C) after strenuous exercise for 2 weeks. He also had a cough with white sputum with a small amount of bright red blood in the sputum and occasional back pain. Diagnoses: The blood tests showed that the patient's antithrombin III concentration and activity were both significantly reduced to 41% and 43.2%, respectively. Enhanced chest computed tomography scans showed pulmonary infarction in the lower lobe of the right lung with multiple embolisms in the bilateral pulmonary arteries and branches. Lower vein angiography revealed a contrast-filling defect of the inferior vena cava and left common iliac vein. Thrombosis was considered as a differential diagnosis. His father and his uncle also had a history of thrombosis. The patient was diagnosed with inherited ATD. Further, peripheral venous blood samples of the family members were collected for whole-exome gene sequencing, and Sanger sequencing was used to verify the gene mutation site in the family. The patient and his father had a SERPINC1 gene duplication mutation: c.1315_1345dupCCTTTCCTGGTTTTTAAGAGAAGTTCCTC (NM000488.4). Interventions: An inferior vena cava filter was inserted to avoid thrombus shedding from the lower limbs. Urokinase was injected intermittently through the femoral vein cannula for thrombolysis. Heparin combined with warfarin anticoagulant therapy was sequentially administered. After reaching the international normalized ratio, heparin was discontinued, and oral warfarin anticoagulant therapy was continued. After discharge, the patient was switched to rivaroxaban as oral anticoagulation therapy. Outcomes: The patient's clinical symptoms disappeared. reexamination showed that the thrombotic load was less than before, and the inferior vena cava filter was then removed. Lessons: By this report we highlight that gene detection and phenotypic analysis are important means to study inherited ATD.
Hereditary Thrombophilia: A Case of Subacute Pulmonary Embolism in a 68-Year-Old Female with a Mutation in the PROC Gene

Ziyang Chen,Hualan Wu,Yuan Xu,Tao Gu,Deping Liu,Ming Lan

DOI: https://doi.org/10.1055/s-0044-1788304

2024-08-18

Seminars in Thrombosis and Hemostasis

Abstract:Thrombophilia, also known as hypercoagulability or prothrombotic condition, typically arises from an imbalance that occurs either in the coagulation pathway or in the anticoagulation/fibrinolytic system due to various hereditary or acquired factors.[1] Thrombophilia can be associated with deficiencies of natural anticoagulants (antithrombin, protein C [PC], and protein S), elevated homocysteine values, and elevations or other changes in fibrinogen and coagulation factors. Conversely, acquired thrombophilia occurs as a result of secondary diseases, such as autoimmune disorders (antiphospholipid syndrome), trauma, or malignancy.[2] [3] The main clinical manifestations of thrombophilia are venous thromboembolism (VTE), such as deep vein thrombosis, pulmonary embolism, intracranial vein thrombosis, portal vein thrombosis, mesenteric vein thrombosis, etc. Certain types of thrombophilia can be manifested as acute coronary syndromes, ischemic stroke, and other arterial thrombotic events.[4] Hereditary thrombophilia is typically autosomal-dominant and has a reported population prevalence of approximately 7%; patients with hereditary thrombophilia can have a risk of VTE that is 3 to 20 times greater than that of the general population.[5] Genetic testing is conducive to confirming the diagnosis of hereditary thrombophilia in families with a known mutation. We report an interesting case of hereditary thrombophilia in a patient who harbored a PROC gene mutation. A 68-year-old elderly female with coronary atherosclerosis and type 2 diabetes presented to the local hospital with recurrent episodes of chest tightness and chest pain while visiting Tibet. She was found to have diminished oxygen saturation (sO2 84%), increased D-dimer (1.64 mg/L, reference A2. The joints were normal, with marked edema of the left lower extremity. Laboratory examination: D-dimer 2.258 mg/L, PC activity assay: 59% (reference range: 70–140%). Doppler echocardiography demonstrated right ventricular wall thickening, dilatation of the main pulmonary artery, and left ventricular ejection fraction of 62%. Ultrasound of the deep veins of the left lower limb demonstrated thrombosis, and computed tomography of pulmonary arteries (CTPA) suggested multiple pulmonary emboli in both lungs with decreased perfusion in the corresponding areas ([Figs. 1] and [2]). We hypothesized that the patient's condition was not characterized by an acute onset, and the severity of the symptoms was not as pronounced as initially anticipated. Given the patient's family history of thrombosis, we also performed the Thrombosis and Hemostasis Gene Panel test, revealing that there was a point mutation in the PROC gene ( PROC : NM_001375607;exon5:c.561_576dup:p.E196Pfs*33) that would lead to a defect in PC function and an enhanced risk of thrombosis. The diagnosis of hereditary thrombophilia was thus confirmed, even though there were additional risk factors—the patient's advanced age, long-distance travel, and non-O blood group. Following the thorough diagnostic work-up, the patient received subcutaneous injections of enoxaparin sodium 60 mg twice per day. After a 10-day treatment period, a noticeable reduction in the circumference of the patient's left lower limb was observed. The D-dimer levels also declined from 2.258 to 0.804 mg/L. The ultrasound indicated that there was little change in the thrombosis of the deep veins. Following the switch from enoxaparin sodium injection to a daily dose of 20 mg of rivaroxaban, the patient was discharged from the hospital. Nevertheless, sh -Abstract Truncated-

peripheral vascular disease,hematology

cDNA microarrays for pharmacogenomic analysis of cystic fibrosis.

Case Report: Laboratory detection of a thrombotic tendency in a family with hypodysfibrinogenemia and a novel FGG mutation

Voice dysfunction in dysarthria: application of the Multi-Dimensional Voice Program.

Congenital Fibrinogen Disorders with Repeated Thrombosis

[Small Maf proteins as transcription factors regulating maturation and maintenance of the cell].

Congenital fibrinogen disorders: a retrospective clinical and genetic analysis of the Prospective Rare Bleeding Disorders Database

Clinical, Laboratory, and Molecular Aspects of Congenital Fibrinogen Disorders

Inherited Disorders of the Fibrinolytic Pathway: Pathogenic Phenotypes and Diagnostic Considerations of Extremely Rare Disorders

A novel γ-chain mutation p.Asp318His in a Chinese family with dysfibrinogenemia

The FGG c.952G>A variant causes congenital dysfibrinogenemia characterized by recurrent cerebral infarction: a case report

Factor V haemostatic diathesis impairing thrombin activation, membrane binding and circulating antigen level due to a novel compound heterozygous mutation, Leu1821Ser and Gly2192Cys

A novel fibrinogen γ-chain frameshift mutation, p. Cys365Phefs*41, causing hypofibrinogenemia with bleeding phenotype in a Chinese family

Hyperfibrinolysis: a crucial phenotypic abnormality of posttraumatic fibrinolytic dysfunction

Human Fibrinogen: Molecular and Genetic Aspects of Congenital Disorders

Real world management of individuals with severe FXI deficiency and its impact on clinical outcomes: Experience from a haemophilia treatment centre

Elevated furin expression in aggressive human head and neck tumors and tumor cell lines

Severe haemorrhagic diathesis due to acquired hypofibrinogenemia in a patient with early T-cell precursor acute lymphoblastic leukaemia/lymphoma: a case report

[Acute arterial thrombosis in a context of hyperhomocysteinemia: Case report and literature review]

A novel fibrinogen variant: dysfibrinogenemia associated with γAsp185Asn substitution

Inherited antithrombin deficiency caused by a mutation in the SERPINC1 gene: A case report

Hereditary Thrombophilia: A Case of Subacute Pulmonary Embolism in a 68-Year-Old Female with a Mutation in the PROC Gene