Abstract:Tomato (Solanum lycopersicum L.) is an important fruit and vegetable crop with high economic value due to its rich vitamins (Friedman. 2002). Over the past five years, due to tomato brown rugose fruit virus (ToBRFV) infection, the tomato production in many countries and regions in Asia, America and Europe have experienced declines in yield and quality (Salem et al. 2023). ToBRFV is a positive-sense single-stranded RNA virus of the genus Tobamovirus in the family Virgaviridae (Salem et al. 2016). In the field, ToBRFV mainly infects solanaceous crops, including tomato and pepper (Zhang et al. 2022). Symptoms on ToBRFV-infected tomato plants mainly include foliar mottle, vein necrosis, and brown mottled rugose fruit (Alfaro-Fernández et al. 2020, Hamborg et al. 2022, Ma et al. 2021). In April 2023, about 150 tomato plants showing leaf curl, brown patch, and rugose surface on fruits were found in a greenhouse grown with about 500 tomato plants in Huludao City, Liaoning province, China. Two leaves and eight fruits from each of 10 symptomatic tomato plants were sampled and subjected to dot enzyme-linked immunosorbent assay (Dot-ELISA) with an antibody against ToBRFV (LV BAO, Chengdu, China); and all samples tested positive. Sap inoculations were prepared from 0.1 g of ToBRFV-positive tomato leaves via homogenization with 0.01 mol·L-1 PBS (phosphate buffered saline, pH 7.2), which were then inoculated mechanically onto 10 tomato cv. Moneymaker and 10 Nicotiana benthamiana plants at four- to six-leaf stage, respectively. At 10 days post inoculation (dpi), the leaf curl symptoms of all tomato plants were shown, which were consistent with those on greenhouse-infected plants. At 5 dpi, the upper leaves of all N. benthamiana plants showed yellowing and curling symptoms. The results of Dot-ELISA assays revealed that these mechanically inoculated plants were positive for ToBRFV. Total RNAs of inoculated and greenhouse-collected samples were extracted using TRIzolTM reagent and analyzed by reverse-transcription (RT)-PCR with specific primers ToBRFV-FD (5' GTCCCGATGTCTGTAAGGCTTGC) and ToBRFV-RD (5' GCAGGTGCAGAGGACCATTGTAA) for ToBRFV detection, respectively. The results showed that a 680-bp fragment was obtained in all tested samples. Then, primers ToBRFV-F1 (5' GTGTATTTTTTACAACATATACC) and ToBRFV-R1 (5' AACCATTGACTCAGAACTC), ToBRFV-F2 (5' TAGCCAAGAATCACGCATG) and ToBRFV-R2 (5' AGCAGCAATAATCACCGTA), ToBRFV-F3 (GAAAGAGTGGGGACGTTACAACATTCATCGGTAAT) and ToBRFV-R3 (TGGGCCCCTACCGGGGGTTCCGGGGGAATTCGAAT) were used to amplify the full-length sequence of ToBRFV using field-collected samples. The methods of primer design are shown in supplemental file 1. The sequence obtained by Sanger sequencing showed 99.86% nucleotide (nt) identity with ToBRFV-SD isolate (accession no. MT018320.1) from Shandong province, China. The full-length sequence of ToBRFV was uploaded to GenBank database with the accession number OR437354. To our knowledge, this is the first report of ToBRFV infecting tomato in Northeast China.

First report of Convolvulus arvensis and Polycarpon tetraphyllum as natural hosts of tomato brown rugose fruit virus

New Weed Hosts for Tomato Brown Rugose Fruit Virus in Wild Mediterranean Vegetation

Solanum elaeagnifolium and S. rostratum as potential hosts of the tomato brown rugose fruit virus

Insight into Population Structure and Evolutionary Analysis of the Emerging Tomato Brown Rugose Fruit Virus

First report of tomato brown rugose fruit virus infecting Solanum lycopersicum in Northeast China

ToBRFV Infects the Reproductive Tissues of Tomato Plants but Is Not Transmitted to the Progenies by Pollination

Screening of wild tomato species and interspecific hybrids for resistance/tolerance to Tomato brown rugose fruit virus (ToBRFV)

Elucidating the nature of seed-borne transmission of tomato brown rugose fruit virus in tomato, bell pepper, and eggplant

Screening of Solanum (sections Lycopersicon and Juglandifolia) germplasm for reactions to the tomato brown rugose fruit virus (ToBRFV)

Molecular Methods for the Simultaneous Detection of Tomato Fruit Blotch Virus and Identification of Tomato Russet Mite, a New Potential Virus–Vector System Threatening Solanaceous Crops Worldwide

Tomato brown rugose fruit virus: An emerging and rapidly spreading plant RNA virus that threatens tomato production worldwide

Identification and management of tomato brown rugose fruit virus in greenhouses in Mexico

Revealing an Iranian Isolate of Tomato Brown Rugose Fruit Virus: Complete Genome Analysis and Mechanical Transmission

Comparative Analysis of Tomato Brown Rugose Fruit Virus Isolates Shows Limited Genetic Diversity

Spread of Tomato Brown Rugose Fruit Virus in Sicily and Evaluation of the Spatiotemporal Dispersion in Experimental Conditions

Screening Local Sicilian Tomato Ecotypes to Evaluate the Response of Tomato Brown Rugose Fruit Virus Infection

Directions from Nature: How to Halt the Tomato Brown Rugose Fruit Virus

Biological and Molecular Characterization of Tomato brown rugose fruit virus (ToBRFV) on Tomato Plants in the State of Palestine

Survey of viruses infecting Solanaceous plants and characterization of Tomato brown rugose fruit virus (ToBRFV) infecting pepper in Egypt

Genetic variability of two Mexican Tomato brown rugose fruit virus isolates and expression of symptoms in tomato and pepper

Transcriptome Analysis of Tomato Leaves Reveals Candidate Genes Responsive to Tomato Brown Rugose Fruit Virus Infection