Site-speci ® c incorporation of an unnatural amino acid into proteins in mammalian cells
K. Sakamoto,Akiko Hayashi,A. Sakamoto,D. Kiga,H. Nakayama,A. Soma,Takatsugu Kobayashi,M. Kitabatake,K. Takio,K. Saito,M. Shirouzu,I. Hirao,S. Yokoyama
Abstract:A suppressor tRNATyr and mutant tyrosyl-tRNA synthetase (TyrRS) pair was developed to incorporate 3-iodo-L-tyrosine into proteins in mammalian cells. First, the Escherichia coli suppressor tRNATyr gene was mutated, at three positions in the D arm, to generate the internal promoter for expression. However, this tRNA, together with the cognate TyrRS, failed to exhibit suppressor activity in mammalian cells. Then, we found that amber suppression can occur with the heterologous pair of E.coli TyrRS and Bacillus stearothermophilus suppressor tRNATyr, which naturally contains the promoter sequence. Furthermore, the ef®ciency of this suppression was signi®cantly improved when the suppressor tRNA was expressed from a gene cluster, in which the tRNA gene was tandemly repeated nine times in the same direction. For incorporation of 3-iodo-L-tyrosine, its speci®c E.coli TyrRS variant, TyrRS(V37C195), which we recently created, was expressed in mammalian cells, together with the B.stearothermophilus suppressor tRNATyr, while 3-iodo-L-tyrosine was supplied in the growth medium. 3-Iodo-L-tyrosine was thus incorporated into the proteins at amber positions, with an occupancy of >95%. Finally, we demonstrated conditional 3-iodo-L-tyrosine incorporation, regulated by inducible expression of the TyrRS(V37C195) gene from a tetracycline-regulated promoter. INTRODUCTION The incorporation of unnatural chemical groups into proteins has increasing importance in protein science and cell biology. Biophysical probes or structural modi®cations have been introduced into proteins by chemical modi®cations of amino acid residues (1) or by semi-synthetic methods involving protein ligations (2). The biosynthesis of proteins containing unnatural amino acids, alloproteins (3), is also a promising way of expanding the structural and chemical diversity in proteins (3±11). The site-speci®c incorporation of unnatural amino acids has been employed to study membrane proteins expressed in Xenopus oocytes (6,7). The utility of `sitespeci®c alloproteins' for regulating the interactions between cell signaling proteins has been shown in experiments in vitro (12). However, the only eukaryotic in vivo system available for alloprotein synthesis has been con®ned to Xenopus oocytes, which has severely limited the yields of alloproteins (7). The availability of alloproteins in mammalian cells should be extended for further applications in cell biology. Unnatural amino acids have been attached to the speci®c adaptor tRNAs corresponding to amber codons (4,10,11), four base codons (13) or arti®cial codons with unnatural bases (14,15). One approach for site-speci®c-alloprotein synthesis involves the synthesis of the aminoacylated forms of the tRNAs, by chemical acylation (16) or by using an aminoacyltRNA synthetase (aaRS) (8,15), before their use in alloprotein synthesis. The adaptor tRNA cannot be reacylated during translation without the speci®c aaRS for the unnatural amino acid. The use of the tRNA in the aminoacylated form is prohibitive to the large-scale synthesis of alloproteins in vitro or in vivo, or to the conditional incorporation of unnatural amino acids regulated by certain signals, such as a signal for the expression of the speci®c tRNA and/or aaRS. *To whom correspondence should be addressed at Department of Biophysics and Biochemistry, Graduate School of Science, University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033, Japan. Tel: +81 3 5841 4395; Fax: +81 3 5841 8057; Email: yokoyama@biochem.s.u-tokyo.ac.jp Present addresses: Akiko Hayashi, Laboratory of Public Health, School of Pharmacy, Tokyo University of Pharmacy and Life Science, 1432-1 Horinouchi, Hachioji, Tokyo 192-0392, Japan Akiko Soma, Department of Chemistry, College of Science, Rikkyo (St Pauls) University, 3-34-1 Nishi-Ikebukuro, Toshima-ku, Tokyo 171-8501, Japan Ichiro Hirao, Research Center for Advanced Science and Technology, University of Tokyo, 4-6-1 Komaba, Meguro-ku, Tokyo 153-8904, Japan 4692±4699 Nucleic Acids Research, 2002, Vol. 30 No. 21 ã 2002 Oxford University Press Downloaded from https://academic.oup.com/nar/article-abstract/30/21/4692/1105179 by guest on 03 February 2018 Another approach involves the use of speci®c tRNA ́aaRS pairs for the unnatural amino acids, allowing the reacylation of the tRNA. Wang et al. have created two variants of Methanococcus jannaschii tyrosyl-tRNA synthetase (TyrRS) that are highly speci®c to O-methyl-L-tyrosine (17) and L-3(2-naphthyl)alanine (18). When these amino acids were supplied in the growth medium, they were actually incorporated at amber positions by these variant enzymes and the cognate suppressor tRNATyr in Escherichia coli cells. The M.jannaschii TyrRS does not recognize E.coli tRNAs, while the E.coli aaRSs do not recognize the suppressor tRNATyr (17). Thus, this archaebacterial tRNATyr ́TyrRS pair is `orthogonal' to the E.coli translation system. To extend this approach to eukaryotic systems, we recently created a 3-iodo-L-tyrosine-speci®c variant of E.coli TyrRS, with the two amino acid replacements Y37V and Q195C (19). This variant enzyme, TyrRS(V37C195), together with the E.coli suppressor tRNATyr, incorporates 3-iodo-L-tyrosine at amber positions in a wheatgerm cell-free translation (19). To use this system in a mammalian cell, the E.coli TyrRS and the cognate suppressor tRNATyr should be expressed and functional in the cell. The pair of a suppressor tRNAGln and glutaminyl-tRNA synthetase (GlnRS) from E.coli, which is orthogonal to the eukaryotic translation system, has been expressed in mammalian cells and caused amber suppression (20). The cytidine at position 9 (C9) in this tRNA was replaced by A to generate the internal promoter for expression in mammalian cells. On the other hand, the corresponding engineering for the E.coli tRNATyr would require three base substitutions in the positions involved in the tertiary interactions that support the L-shaped structure, which could impair tRNA function. This dif®culty has been circumvented by importing the aminoacylated form of this suppressor tRNATyr, with no such substitutions, into mammalian cells (21). In the present study, the Bacillus stearothermophilus suppressor tRNATyr was expressed in mammalian cells together with E.coli TyrRS(V37C195), for the incorporation of 3-iodo-L-tyrosine into proteins (Fig. 1); the Bacillus tRNATyr contains the internal promoters in its native sequence (Fig. 2), and can be recognized by E.coli TyrRS (22). Finally, we created a cell line that stably maintains this variant TyrRS gene expressed from a tetracycline-regulated promoter, for conditional incorporation of 3-iodo-L-tyrosine in the presence of this inducer. MATERIALS AND METHODS tRNA genes for the expression in mammalian cells The human, E.coli and B.stearothermophilus suppressor tRNATyr genes were constructed by annealing two oligodeoxynucleotides, commercially synthesized by Amersham Pharmacia Biotech; each gene consists of the corresponding tRNA sequence, lacking the 3¢-CCA, and the 5¢̄anking sequence (AGCGCTCCGGTTTTTCTGTGCTGAACCTCAGGGGACGCCGACACACGTACACGTC) of the human tRNATyr gene (23), linked to the 5¢ end of the tRNA sequence. These genes were each cloned within the EcoRI and HindIII sites of pBR322. The gene cluster consisting of nine unidirectional copies of the B.stearothermophilus suppressor tRNATyr gene was constructed by the following two steps (Fig. 3). First, three PCRs, each with distinct sets of primers, were performed, using a GeneAmp PCR system 9700 (Applied Biosystems). The ®rst reaction produced a primerbinding site (pbs1) at one end, upstream of the gene, and a BstXI site, CCAGCAGACTGG (designated BstXI-1), at the other end, downstream of the gene. The second reaction produced the BstXI-1 site and another type of BstXI site, CCAGCTTCCTGG (BstXI-2), at the `upstream' and `downstream' ends, respectively, while the third reaction produced the BstXI-2 site (upstream) and the other primer-binding site, pbs2 (downstream). These PCR products were ligated with each other to generate a sub-cluster consisting of three copies of the tRNA gene. This sub-cluster was ampli®ed with the primers for pbs1 and pbs2, each with an additional sequence for a restriction site, to generate EcoRI and HindIII sites at the `pbs1' and `pbs2' ends, respectively. The HindIII±EcoRI and EcoRI±BamHI sites, each in the order of the pbs1 to pbs2 ends, were also generated similarly. Thus, three types of the subcluster with different combinations of the restriction sites were ®nally produced. These sub-clusters were cloned together within the EcoRI and BamHI sites of pBR322 to generate a plasmid carrying nine copies of the Bacillus suppressor tRNATyr gene. Construction of TyrRS genes and reporter genes The FLAG tag (DYKDDDDK) was added to the C-termini of the wild-type TyrRS and TyrRS(V37C195) genes, the ras gene and the epidermal growth factor receptor gene (24) by amplifying these genes with appropriate PCR primers. The Figure 1. The mammalian cell system for incorporating 3-iodo-L-tyrosine into proteins in response to amber codons. 3-Iodo-L-tyrosine (IY), present together with L-tyrosine (Y) in the growth medium, is taken up into the cell and is then attached, by its speci®c E.coli mutant TyrRS, to the B.stearothermophilus (B. s.) suppressor tRNATyr. This tRNA carries this unnatural amino acid to the amber codon on the mRNA and incorporates it into a protein (alloprotein). On the other hand, the endogenous, mammalian tRNATyr ́TyrRS pair incorporates L-tyrosine into the proteins at the corresponding tyrosine codon. Nucleic Acids Research, 2002, Vol. 30 No. 21 4693 Downloaded from https://academic.oup.com/nar/article-abstract/30/21/4692/1105179 by guest on 03 February 2018 PCR products were each cloned into the vector pcDNA3.1/ Zeo(+) (Invitrogen) for expression in mammalian cells. For TyrRS(V37C195), the PCR product was also cloned into the vector pcDNA4/TO (Invitrogen) to generate plasmid pEYSM