Familial Vitreous Amyloidosis Resulting from Transthyretin Variant Gly83Arg
Bing Xie,Shanjun Cai,Jinhan Mo,Hong Li,Gang Su
DOI: https://doi.org/10.1111/aos.13425
2017-01-01
Acta Ophthalmologica
Abstract:Familial vitreous amyloidosis is a rare autosomal dominant hereditary disease that is associated with genetic variants of transthyretin (TTR) and is characterized by the deposition of amyloid substances in vitreous fluid (Doft et al. 1987). We reported the clinical and genetic characteristics of Han Chinese kindred from the mainland with vitreous amyloidosis. Here, we report the clinical and pathological features of a novel TTR variant associated with vitreous amyloidosis. The proband (Fig. 1A, III-3), a 47-year-old woman, presented with symptoms of bilateral vision loss and floaters over the previous 8 years that were aggravated within the past 3 years. Her visual acuity (VA) was determined using counting fingers optical density (OD) and hand motion OS. Anterior segment examination and IOPs were normal in both eyes. Dilated fundus examination revealed bilateral wool-like opacities in the vitreous. B-scan ultrasonography detected echo-dense lesions in the vitreous cavity. The results of a general physical examination and laboratory evaluation were normal, including cranial magnetic resonance imaging (MRI) and echocardiography, without evidence of cardiac amyloidosis. A 20-G therapeutic pars plana vitrectomy was performed bilaterally in succession, improving the VA to 20 of 20. A vitreous sample demonstrated ‘apple-green’ birefringence after being stained by Congo red and viewed under polarized light, which was indicated as the amyloid nature of the vitreous specimen. Her family member (II-9, II-12, III-1, III-4, III-5, III-6, III-13) had the same phenotype and had received vitrectomies. Genomic DNA was extracted from peripheral vein whole blood treated with ethylenediaminetetraacetic acid (EDTA) from eight patients and two normal controls. The coding regions of the TTR gene were amplified by polymerase chain reaction (PCR) using 50-μl reactions and the following cycling conditions: 95°C, 3 min, then 35 cycles of 98°C, 10 seconds; 60°C, 15 seconds; and 72°C, 2 min. For exons 1 and 2, the primers were flanking intron sequences (5′-3′) GCAGTCAGATTGGCAGGGATAAGC and GGGCATCCTTCAGAGGGCATACTT; for exon 3, TGCTGGCAAAGAGTTATCAGAGAGGTTA and GAGAAGCCAGATGTGTTTTGGAATAAG; and for exon 4, AATGCTAAATCTCTAAGTCTGTGGTTGGC and GCCTTTCACAGGAATGTTTTATTGTCTCT. All samples were purified and recovered; four TTR exons were directly sequenced in both forward and reverse with an ABI 3730 DNA analyser (Applied Biosystems, Foster City, CA, USA). Data were collected and analysed using dnaman Windows 5.2.2.0 software (Lynnon, San Ramon, CA, USA) and Chromas DNA sequencing software (Technelysium, South Brisbane, QLD, Australia). Genetic analysis of exon 3 of the TTR gene revealed that the patients were heterozygous for a single nucleotide substitution (3930 G>C) (Fig. 1B). This substitution resulted in an amino acid change from glycine (GGC) to arginine (CGC) at codon 83. However, there was no similar change among the normal controls. Mutations in the TTR gene are the most common causes of hereditary amyloidosis. Among more than 100 amyloid-genic TTR gene mutations, 99% are concentrated at exons 2, 3 and 4. ATTR Val30Met is the most common mutation worldwide, with substantial foci in Portugal, Sweden and Japan. Other common mutations are Val28Met, Leu58His, Leu58Arg, Lys78Phe, Ile84Ser, Tyr114His, Trp41Leu, Tyr69His, Asp18Glu, Val30Gly, Gly67Glu, Gly83Arg, Arg54Gly, Lys35Thr and Leu55Arg. In the mainland Chinese population, Zhang reported three families with a total of 26 subjects who had the G83R mutation (Zhang et al. 2013). Liu reported 12 affected individuals heterozygous for the missense Gly83Arg mutation in TTR from a five-generation Chinese family (Liu et al. 2014). Our patient was heterozygous for the novel Gly83Arg TTR mutation. So far, however, no related research has been reported regarding this rare mutant form of the TTR gene except in the Chinese Han population. We speculate that the Gly83Arg heterozygous mutation is a novel and characteristic variant of the TTR gene in the Chinese Han family. The study was supported by the National Natural Science Foundation of China (81360150) and the Science and Technology Foundation of Guizhou Province, China (No. 2014-7007).