RESISTANCE OF THE HOUSE FLY TO BACILLUS THURINGIENSIS BERLINER.

T. Harvey,D. Howell

DOI: https://doi.org/10.1016/0022-2011(65)90160-6

IF: 2.795

1965-03-01

Journal of Invertebrate Pathology

Abstract:

What problem does this paper attempt to address?

A novel frameshift GRN mutation results in frontotemporal lobar degeneration with a distinct clinical phenotype in two siblings: case report and literature review

Takashi Hosaka,Kazuhiro Ishii,Takeshi Miura,Naomi Mezaki,Kensaku Kasuga,Takeshi Ikeuchi,Akira Tamaoka

DOI: https://doi.org/10.1186/s12883-017-0959-2

2017-09-15

Abstract:Background: Progranulin gene (GRN) mutations are major causes of frontotemporal lobar degeneration. To date, 68 pathogenic GRN mutations have been identified. However, very few of these mutations have been reported in Asians. Moreover, some GRN mutations manifest with familial phenotypic heterogeneity. Here, we present a novel GRN mutation resulting in frontotemporal lobar degeneration with a distinct clinical phenotype, and we review reports of GRN mutations associated with familial phenotypic heterogeneity. Case presentation: We describe the case of a 74-year-old woman with left frontotemporal lobe atrophy who presented with progressive anarthria and non-fluent aphasia. Her brother had been diagnosed with corticobasal syndrome (CBS) with right-hand limb-kinetic apraxia, aphasia, and a similar pattern of brain atrophy. Laboratory blood examinations did not reveal abnormalities that could have caused cognitive dysfunction. In the cerebrospinal fluid, cell counts and protein concentrations were within normal ranges, and concentrations of tau protein and phosphorylated tau protein were also normal. Since similar familial cases due to mutation of GRN and microtubule-associated protein tau gene (MAPT) were reported, we performed genetic analysis. No pathological mutations of MAPT were identified, but we identified a novel GRN frameshift mutation (c.1118_1119delCCinsG: p.Pro373ArgX37) that resulted in progranulin haploinsufficiency. Conclusion: This is the first report of a GRN mutation associated with familial phenotypic heterogeneity in Japan. Literature review of GRN mutations associated with familial phenotypic heterogeneity revealed no tendency of mutation sites. The role of progranulin has been reported in this and other neurodegenerative diseases, and the analysis of GRN mutations may lead to the discovery of a new therapeutic target.
Meeting carers' information needs.

Alison Jarvis,A. Worth

2005-09-01

Abstract:Unpaid carers provide the backbone for community care, supplying the everyday support and care to users which paid carers would otherwise have to provide. There is increasing political awareness about the need to support carers if the rhetoric of community care is to be a reality. Both research and policy documents emphasise the carer's need for information. Carers see the Primary Health Care Team as being pivotal in providing them with advice, support and information. This paper describes a study to identify carers in a general practice and to provide them with information. A large scale mailed survey of all adults in the practice was used to identify carers who were then asked if they wanted a pack of local information. Of the patients who responded, 6% identified themselves as a carer and of these, 63% requested information.
CD4+CD25+ Regulatory T Cells Control Innate Immune Reactivity after Injury1

T. Murphy,N. N. Choileain,Y. Zang,J. Mannick,J. Lederer

DOI: https://doi.org/10.4049/jimmunol.174.5.2957

2005-03-01

Abstract:Major injury initiates a systemic inflammatory response that can be detrimental to the host. We have recently reported that burn injury primes innate immune cells for a progressive increase in TLR4 and TLR2 agonist-induced proinflammatory cytokine production and that this inflammatory phenotype is exaggerated in adaptive immune system-deficient (Rag1−/−) mice. The present study uses a series of adoptive transfer experiments to determine which adaptive immune cell type(s) has the capacity to control innate inflammatory responses after injury. We first compared the relative changes in TLR4- and TLR2-induced TNF-α, IL-1β, and IL-6 production by spleen cell populations prepared from wild-type (WT), Rag1−/−, CD4−/−, or CD8−/− mice 7 days after sham or burn injury. Our findings indicated that splenocytes prepared from burn-injured CD8−/− mice displayed TLR-induced cytokine production levels similar to those in WT mice. In contrast, spleen cells from burn-injured CD4−/− mice produced cytokines at significantly higher levels, equivalent to those in Rag1−/− mice. Moreover, reconstitution of Rag1−/− or CD4−/− mice with WT CD4+ T cells reduced postinjury cytokine production to WT levels. Additional separation of CD4+ T cells into CD4+CD25+ and CD4+CD25− subpopulations before their adoptive transfer into Rag1−/− mice showed that CD4+CD25+ T cells were capable of reducing TLR-stimulated cytokine production levels to WT levels, whereas CD4+CD25− T cells had no regulatory effect. These findings suggest a previously unsuspected role for CD4+CD25+ T regulatory cells in controlling host inflammatory responses after injury.
Progranulin Gene Mutations in Chinese Patients with Frontotemporal Dementia: A Case Report and Literature Review

Min Chu,Haitian Nan,Deming Jiang,Li Liu,Anqi Huang,Yihao Wang,Liyong Wu

DOI: https://doi.org/10.3233/JAD-230052

Abstract:Background: Progranulin (GRN) mutations in frontotemporal dementia (FTD) have been less frequently reported in China than in Western countries. Objective: This study reports a novel GRN mutation and summarizes the genetic and clinical features of patients with GRN mutations in China. Methods: Comprehensive clinical, genetic, and neuroimaging examinations were conducted on a 58-year-old female patient diagnosed with semantic variant primary progressive aphasia. A literature review was also conducted and clinical and genetic features of patients with GRN mutations in China were summarized. Results: Neuroimaging revealed marked lateral atrophy and hypometabolism in the left frontal, temporal, and parietal lobes. The patient was negative for pathologic amyloid and tau deposition by positron emission tomography. A novel heterozygous 45-bp deletion (c.1414-14_1444delCCCTTCCCCGCCAGGCTGTGTGCTGCGAGGATCGCCAGCACTGCT) was detected by whole-exome sequencing of the patient's genomic DNA. Nonsense-mediated mRNA decay was presumed to be involved in the degradation of the mutant gene transcript. The mutation was deemed pathogenic according to American College of Medical Genetics and Genomics criteria. The patient had a reduced plasma GRN level. In the literature, there were reports of 13 Chinese patients - mostly female - with GRN mutations; the prevalence was 1.2% -2.6% and patients mostly had early disease onset. Conclusion: Our findings expand the mutation profile of GRN in China, which can aid the diagnosis and treatment of FTD.
An Alternative In Vitro Model Of Neurodegeneration In Ftld-U With Pgrn Mutation

michael a gitcho,odity mukherjee,jun wang,sumi chakraverty,jeffrey strider,joanne norton,alison goate,nigel j cairns

DOI: https://doi.org/10.1096/fasebj.22.1_supplement.58.7

2008-01-01

Abstract:Recently, the gene for familial frontotemporal lobar degeneration with ubiquitin‐positive, tau‐negative inclusions (FTLD‐U) linked to chromosome 17 was cloned. In the present study, 42 unrelated patients from the Washington University Alzheimer's Disease Research Center (WUADRC) with clinically diagnosed FTLD and/or neuropathologically characterized cases of FTLD‐U with or without MND were screened for mutations in PGRN . Bidirectional sequencing was performed for mutational screening. Mechanistically, most mutations in PGRN described thus far have been reported to display a haploinsufficiency through nonsense mediated decay (NMD). We describe a novel missense mutation in exon 1 (c.4068 C>A) introducing a charged amino acid in the hydrophobic core of the signal peptide at residue 9 (A9D) which displayed no significant difference in the total postmortem brain PGRN mRNA between cases and controls. In SHSY‐5Y neuroblastoma cells overexpressed with mutant or wild‐type PGRN , subcellular fractionation, biochemistry, and confocal microscopy indicate that mutant protein is expressed, but is not processed, through the ER for secretion, and appears to be misslocalized in the cytosol possibly resulting in a functional haploinsufficiency. This defect in trafficking results in a decrease in cell viability: an alternative in vitro model of FTLD‐U with PGRN mutation neurodegeneration. Support for this work was provided by grants from the National Institute on Aging of the National Institutes of Health (P01‐AG03991, P50‐AG05681) and the Buchanan Fund.
A novel GRN mutation (GRN c.708+6_+9delTGAG) in frontotemporal lobar degeneration with TDP-43-positive inclusions: clinicopathologic report of 6 cases

Esther N Bit-Ivan,Eunran Suh,Hyung-Sub Shim,Sandra Weintraub,Bradley T Hyman,Steven E Arnold,Elisabeth McCarty-Wood,Viviana M Van Deerlin,Julie A Schneider,John Q Trojanowski,Matthew P Frosch,Matt C Baker,Rosa Rademakers,Marsel Mesulam,Eileen H Bigio

DOI: https://doi.org/10.1097/NEN.0000000000000070

Abstract:Understanding of frontotemporal lobar degeneration, the underlying pathology most often linked to the clinical diagnosis of frontotemporal dementia, is rapidly increasing. Mutations in 7 known genes (MAPT, GRN, C9orf72, VCP, CHMP2B, and, rarely, TARDBP and FUS) are associated with frontotemporal dementia, and the pathologic classification of frontotemporal lobar degeneration has recently been modified to reflect these discoveries. Mutations in one of these genes (GRN), which encodes progranulin, have been implicated in up to a quarter of cases of frontotemporal lobar degeneration with TDP-43 (TAR DNA-binding protein 43)-positive inclusions; currently, there are more than 60 known pathogenic mutations of the gene. We present the clinical, pathologic, and genetic findings on 6 cases from 4 families, 5 of which were shown to have a novel GRN c.708+6_+9delTGAG mutation.
Clinical, neuropathological, and genetic characteristics of the novel IVS9+1delG GRN mutation in a patient with frontotemporal dementia

Ricardo Taipa,Assunção Tuna,Joana Damásio,Pedro S Pinto,Sara Cavaco,Sonia Pereira,Gabriel Milterberger-Miltenyi,Daniela Galimberti,Manuel Melo-Pires

DOI: https://doi.org/10.3233/JAD-2012-112084

Abstract:Frontotemporal lobar degeneration (FTLD) refers to a clinically, pathologically, and genetically heterogeneous group of dementias that arises from the degeneration of the frontal and temporal lobes. Mutations in the progranulin gene (GRN) are a major cause of FTLD with TDP-43 inclusions. Herein, we describe the clinical, neuropathological, and genetic findings in a case of autosomal dominant behavioral variant of frontotemporal dementia (bvFTD) with asymmetrical parkinsonism and prominent visuospatial deficits that carries a novel GRN mutation. This case highlights important clinical characteristics that seem to be common in FTLD GRN-associated patients, such as asymmetrical parkinsonism and parietal symptoms, and that are correlated to the pathological involvement of striatum (rather than substantia nigra in our case) and parietal lobe. We also emphasize that plasma progranulin level can be useful to infer about the pathogenicity of new GRN mutations.
Renal failure after bone-marrow transplantation

E. Cohen

DOI: https://doi.org/10.1016/S0140-6736(00)03561-3

IF: 202.731

2001-01-06

The Lancet

Abstract:
Pharmacokinetics of the TRPV1 Antagonist ABT‐102 in Healthy Human Volunteers: Population Analysis of Data From 3 Phase 1 Trials

Ahmed A. Othman,W. Nothaft,W. Awni,S. Dutta

DOI: https://doi.org/10.1177/0091270011407497

2012-07-01

Abstract:ABT‐102 is a selective TRPV1 antagonist with robust efficacy in several preclinical models of pain. Three phase 1 studies evaluated ABT‐102 pharmacokinetics upon oral administration to healthy human volunteers: a single‐dose study (2, 6, 18, 30, and 40 mg) and a multiple‐dose study (2, 4, and 8 mg twice daily for 7 days) using a solution formulation and a multiple‐dose study (1, 2, and 4 mg twice daily for 7 days) using a solid‐dispersion formulation. These studies followed double‐blind, randomized, placebo‐controlled designs. ABT‐102 exhibited dose‐ and time‐linear pharmacokinetics. ABT‐102 half‐life ranged from 7 to 11 hours, and steady state was achieved by day 5 of dosing. Population analysis of the pharmacokinetic data from the 3 studies was conducted. A 1‐compartment model with a transit compartment for absorption and first‐order elimination provided best fit to the data. The model included formulation‐dependent lag times and a bioavailability factor (Frel) for solution relative to solid dispersion. The population parameter estimates (95% bootstrap confidence intervals) were oral clearance, 16 (14–18) L/h; oral volume of distribution, 215 (192–237) L; transit rate constant, 1.4 (1.3–1.6) h−1; solid‐dispersion lag, 0.6 (0.5–0.8) h; solution lag, 0.3 (0.2–0.4) h; and solution Frel, 40% (35%–45%). Evaluation of ABT‐102 pharmacokinetic model indicated its robustness and adequacy.
Lrp, a leucine-responsive protein, regulates branched-chain amino acid transport genes in Escherichia coli

S. Haney,J. Platko,D. Oxender,J. Calvo

DOI: https://doi.org/10.1128/jb.174.1.108-115.1992

IF: 3.2

1992-01-01

Journal of Bacteriology

Abstract:We investigated the relationship between two regulatory genes, livR and lrp, that map near min 20 on the Escherichia coli chromosome. livR was identified earlier as a regulatory gene affecting high-affinity transport of branched-chain amino acids through the LIV-I and LS transport systems, encoded by the livJ and livKHMGF operons. lrp was characterized more recently as a regulatory gene of a regulon that includes operons involved in isoleucine-valine biosynthesis, oligopeptide transport, and serine and threonine catabolism. The expression of each of these livR- and lrp-regulated operons is altered in cells when leucine is added to their growth medium. The following results demonstrate that livR and lrp are the same gene. The lrp gene from a livR1-containing strain was cloned and shown to contain two single-base-pair substitutions in comparison with the wild-type strain. Mutations in livR affected the regulation of ilvIH, an operon known to be controlled by lrp, and mutations in lrp affected the regulation of the LIV-I and LS transport systems. Lrp from a wild-type strain bound specifically to several sites upstream of the ilvIH operon, whereas binding by Lrp from a livR1-containing strain was barely detectable. In a strain containing a Tn10 insertion in lrp, high-affinity leucine transport occurred at a high, constitutive level, as did expression from the livJ and livK promoters as measured by lacZ reporter gene expression. Taken together, these results suggest that Lrp acts directly or indirectly to repress livJ and livK expression and that leucine is required for this repression. This pattern of regulation is unusual for operons that are controlled by Lrp.
Pathogenic cysteine mutations affect progranulin function and production of mature granulins.

Jun Wang,Philip Van Damme,Carlos Cruchaga,Michael A Gitcho,Jose Manuel Vidal,Manuel Seijo-Martínez,Lei Wang,Jane Y Wu,Wim Robberecht,Alison Goate

DOI: https://doi.org/10.1111/j.1471-4159.2009.06546.x

2010-01-01

Journal of Neurochemistry

Abstract:P>Frontotemporal dementia with ubiquitin-positive inclusions (FTLD-U) can be caused by mutations in the progranulin gene (GRN). Progranulin (PGRN) is a cysteine-rich growth factor, which is proteolytically cleaved by elastase to produce several granulins (GRNs). All FTLD-U mutations in GRN characterized to date result in reduced secreted PGRN protein. We recently reported a Spanish family with progressive non-fluent aphasia and dementia in which a novel C521Y mutation segregates with disease. A second cysteine mutation (C139R) has also been reported to be disease specific. Allele-specific mRNA expression assays in brain reveal that the C521Y mutant allele is expressed at similar levels to the wild-type allele. Furthermore, plasma PGRN levels in C521Y carriers are comparable with non-carrier family relatives, suggesting that the mutation does not affect PGRN protein expression and secretion in vivo. Despite normal PGRN levels C521Y and C139R mutant GRNs show reduced neurite growth-stimulating activity in vitro. Further study revealed that these mutations also cause impaired cleavage of PGRN by elastase. Our data suggest that these mutations affect the function of full-length PGRN as well as elastase cleavage of PGRN into GRNs, leading to neurodegeneration.
Frontotemporal Dementia due to the Novel GRN Arg161GlyfsX36 Mutation

Stefano Gazzina,Silvana Archetti,Antonella Alberici,Elisa Bonomi,Maura Cosseddu,Diego Di Lorenzo,Alessandro Padovani,Barbara Borroni

DOI: https://doi.org/10.3233/JAD-170066

Abstract:Progranulin is a multifunctional growth factor mainly expressed in neurons and microglia. Loss-of-function mutations in the Granulin (GRN) gene are causative of frontotemporal dementia with TAR DNA-binding protein-43 inclusions. We reported the case of a 51-year-old male patient affected by sporadic agrammatic variant of primary progressive aphasia, in whom we identified a novel heterozygous deletion in the exon 6 (g.10338_39delAG, p.Arg161GlyfsX36). Plasma progranulin levels were significantly reduced and in silico analysis predicted a premature termination codon. This case expands our knowledge on GRN mutations in frontotemporal dementia.
Intrafamilial clinical phenotypic heterogeneity with progranulin gene p.Glu498fs mutation

A J Larner

DOI: https://doi.org/10.1016/j.jns.2012.01.005

2012-05-15

Abstract:A patient with a progressive aphasia syndrome underwent progranulin gene (GRN) testing in light of a family history of early-onset dementia in two of her brothers, one of whom had been previously examined and had the phenotype of frontal variant frontotemporal dementia. The proband was found to have the p.Glu498fs mutation. This is only the second English family, and the fifth family overall, to be described with this GRN mutation. There was marked intrafamilial phenotypic heterogeneity with respect to age at onset and clinical presentation. The mechanisms underpinning this heterogeneity, as seen with other GRN mutations, are currently unknown. Since all GRN mutations lead to progranulin haploinsufficiency, other modifying factors, possibly genetic, are implicated.
Deficiency of the frontotemporal dementia gene GRN results in gangliosidosis

Sebastian Boland,Sharan Swarup,Yohannes A. Ambaw,Pedro C. Malia,Ruth C. Richards,Alexander W. Fischer,Shubham Singh,Geetika Aggarwal,Salvatore Spina,Alissa L. Nana,Lea T. Grinberg,William W. Seeley,Michal A. Surma,Christian Klose,Joao A. Paulo,Andrew D. Nguyen,J. Wade Harper,Tobias C. Walther,Robert V. Farese

DOI: https://doi.org/10.1038/s41467-022-33500-9

2022-10-09

Abstract:Haploinsufficiency of GRN causes frontotemporal dementia (FTD). The GRN locus produces progranulin (PGRN), which is cleaved to lysosomal granulin polypeptides. The function of lysosomal granulins and why their absence causes neurodegeneration are unclear. Here we discover that PGRN-deficient human cells and murine brains, as well as human frontal lobes from GRN -mutation FTD patients have increased levels of gangliosides, glycosphingolipids that contain sialic acid. In these cells and tissues, levels of lysosomal enzymes that catabolize gangliosides were normal, but levels of bis(monoacylglycero)phosphates (BMP), lipids required for ganglioside catabolism, were reduced with PGRN deficiency. Our findings indicate that granulins are required to maintain BMP levels to support ganglioside catabolism, and that PGRN deficiency in lysosomes leads to gangliosidosis. Lysosomal ganglioside accumulation may contribute to neuroinflammation and neurodegeneration susceptibility observed in FTD due to PGRN deficiency and other neurodegenerative diseases.

English Else
Frontotemporal Dementia Patient Neurons With Progranulin Deficiency Display Protein Dyshomeostasis

Lisa Elia,Bianca Herting,Amela Alijagic,Christina Buselli,Leela Wong,Grace Morrison,Miguel A Prado,Joao A Paulo,Steven P Gygi,Daniel Finley,Steven Finkbeiner

DOI: https://doi.org/10.1101/2023.01.18.524611

2023-01-20

bioRxiv

Abstract:Haploinsufficiency of progranulin (PGRN) causes frontotemporal dementia (FTD), a devastating neurodegenerative disease with no effective treatment. PGRN is required for efficient proteostasis, as loss of neuronal PGRN results in dysfunctional lysosomes and impaired clearance and cytoplasmic aggregation of TDP-43, a protein involved in neurodegeneration in FTD. These and other events lead to neurodegeneration and neuroinflammation. However, the detailed mechanisms leading to protein dyshomeostasis in PGRN-deficient cells remain unclear. We report here the development of human cell models of FTD with PGRN-deficiency to explore the molecular mechanisms underlying proteostasis breakdown and TDP-43 aggregation in FTD. Neurons differentiated from FTD patient induced pluripotent stem cells (iPSCs) have reduced PGRN levels, and the neurons recapitulate key disease features, including impaired lysosomal function, defective TDP-43 turnover and accumulation, neurodegeneration, and death. Proteomic analysis revealed altered levels of proteins linked to the autophagy-lysosome pathway (ALP) and the ubiquitin-proteasome system (UPS) in FTD patient neurons, providing new mechanistic insights into the link between PGRN-deficiency and disease pathobiology.
Diffusion tensor imaging for multilevel assessment of the visual pathway: possibilities for personalized outcome prediction in autoimmune disorders of the central nervous system

J. Kuchling,A. Brandt,F. Paul,M. Scheel

DOI: https://doi.org/10.1007/s13167-017-0102-x

IF: 6.5

2017-07-25

The EPMA Journal

Abstract:
GRN mutation in a patient with a behavioral variant of frontotemporal lobar degeneration (bvFTD)

Sylwia Walczysková,Pavel Ressner,Šárka Hilscherová,Jaroslav Kotlas,Jiří Konrád,Věnceslava Svobodová

DOI: https://doi.org/10.5114/fn.2017.66715

Abstract:The clinical spectrum of frontotemporal lobar degeneration (FTLD) is characterized by personality changes, language impairment, and executive function deficits. About 40% of FTLD cases have a family history of the disease, and the GRN gene is currently the most frequent genetic determinant. In cases of inherited FTLD with GRN mutations, parkinsonism is often an early sign due to greater grey matter atrophy in the caudate nucleus and bilateral atrophy in the thalamus. We investigated a female patient with signs of frontotemporal lobe atrophy and unilateral caudate nucleus atrophy on MRI. DNA was isolated from peripheral blood leukocytes and tested for GRN gene mutations. A pathogenic splice donor site mutation, c.708+1G>A, was found in the GRN gene. MRI showed unilateral caudate nucleus atrophy. This report extends the evidence for phenotypic and neuropathological heterogeneity in FTLD spectrum disorders due to splicing mutations in the GRN gene. .
A cluster of progranulin C157KfsX97 mutations in Southern Italy: clinical characterization and genetic correlations

Cinzia Coppola,Dario Saracino,Gianfranco Puoti,Giacomo Lus,Clemente Dato,Isabelle Le Ber,Jeremie Pariente,Paola Caroppo,Elena Piccoli,Fabrizio Tagliavini,Giuseppe Di Iorio,Giacomina Rossi

DOI: https://doi.org/10.1016/j.neurobiolaging.2016.10.008

Abstract:Frontotemporal lobar degeneration (FTLD) is a group of neurodegenerative diseases displaying high clinical, pathologic, and genetic heterogeneity. Several autosomal dominant progranulin (GRN) mutations have been reported, accounting for 5%-10% of FTLD cases worldwide. In this study, we described the clinical characteristics of 7 Italian patients, 5 with a diagnosis of frontotemporal dementia behavioral variant and 2 of corticobasal syndrome (CBS), carrying the GRN deletion g.101349_101355delCTGCTGT, resulting in the C157KfsX97 null mutation, and hypothesized the existence of a founder effect by means of haplotype sharing analysis. We performed plasma progranulin dosage, GRN gene sequencing, and haplotype sharing study, analyzing 10 short tandem repeat markers, spanning a region of 11.08 Mb flanking GRN on chromosome 17q21. We observed shared alleles among 6 patients for 8 consecutive short tandem repeat markers spanning a 7.29 Mb region. Therefore, also with this particular mutation, the elevated clinical variability described among GRN-mutated FTLD cases is confirmed. Moreover, this is the first study reporting the likely existence of a founder effect for C157KfsX97 mutation in Southern Italy.
An Examination of the Associations between Life Problems and Psychiatric Disorders in a Rural Patient Population

P. Yellowlees,A. Kaushik

DOI: https://doi.org/10.3109/00048679409075845

1994-03-01

Abstract:The objective of this clinical study was to examine the differential effects of adversity on pathology. Data obtained from a previously described consecutive series of 707 patients was re-analysed to this effect. A series of specific life events, as well as behaviours that were likely to be secondary to psychiatric disorder, were examined. High rates of life problems such as incest, sexual assault, domestic violence, suicide attempts, and alcohol, tranquilliser and substance abuse were found in the group of patients in general. There were no major differences in the prevalence of these problems in patients with major functional disorders, anxiety disorders, short-lived minor psychiatric disorders, or in “control” patients with no primary Axis I or Axis II diagnosis. Patients with personality disorders as their major psychiatric diagnosis did, however, experience higher levels of the majority of these problems. The clinical implications of the findings are discussed. It is concluded that patients who develop chronic psychiatric illnesses are probably more psychologically or biologically vulnerable than those patients who develop short-lived disorders and who do not achieve a major psychiatric diagnosis from the practising clinician.
Extensive white matter involvement in patients with frontotemporal lobar degeneration: think progranulin

Paola Caroppo,Isabelle Le Ber,Agnès Camuzat,Fabienne Clot,Lionel Naccache,Foudil Lamari,Anne De Septenville,Anne Bertrand,Serge Belliard,Didier Hannequin,Olivier Colliot,Alexis Brice

DOI: https://doi.org/10.1001/jamaneurol.2014.1316

Abstract:Importance: Mutations in the progranulin (GRN) gene are responsible for 20% of familial cases of frontotemporal dementias. All cause haploinsufficiency of progranulin, a protein involved in inflammation, tissue repair, and cancer. Carriers of the GRN mutation are characterized by a variable degree of asymmetric brain atrophy, predominantly in the frontal, temporal, and parietal lobes. We describe 4 GRN mutation carriers with remarkable widespread white matter lesions (WML) associated with lobar atrophy shown on magnetic resonance imaging. Observations: Four GRN mutation carriers (age at onset, 56-65 years) presenting with severe WML were selected from 31 GRN mutation carriers who were followed up in our dementia centers. The WML were predominantly in the frontal and parietal lobes and were mostly confluent, affecting the periventricular subcortical white matter and U-fibers. In all patients, common vascular, metabolic, inflammatory, dysimmune, and mitochondrial disorders were excluded and none had severe vascular risk factors. Conclusions and relevance: Our data suggest that white matter involvement may be linked to progranulin pathological processes in a subset of GRN mutation carriers. The plasma progranulin measurement, which is predictive of GRN mutations, and GRN sequencing should thus be included in investigations of patients with frontotemporal lobar degenerations who show unusual white matter hyperintensities and atrophy on magnetic resonance imaging.

RESISTANCE OF THE HOUSE FLY TO BACILLUS THURINGIENSIS BERLINER.

A novel frameshift GRN mutation results in frontotemporal lobar degeneration with a distinct clinical phenotype in two siblings: case report and literature review

Meeting carers' information needs.

CD4+CD25+ Regulatory T Cells Control Innate Immune Reactivity after Injury1

Progranulin Gene Mutations in Chinese Patients with Frontotemporal Dementia: A Case Report and Literature Review

An Alternative In Vitro Model Of Neurodegeneration In Ftld-U With Pgrn Mutation

A novel GRN mutation (GRN c.708+6_+9delTGAG) in frontotemporal lobar degeneration with TDP-43-positive inclusions: clinicopathologic report of 6 cases

Clinical, neuropathological, and genetic characteristics of the novel IVS9+1delG GRN mutation in a patient with frontotemporal dementia

Renal failure after bone-marrow transplantation

Pharmacokinetics of the TRPV1 Antagonist ABT‐102 in Healthy Human Volunteers: Population Analysis of Data From 3 Phase 1 Trials

Lrp, a leucine-responsive protein, regulates branched-chain amino acid transport genes in Escherichia coli

Pathogenic cysteine mutations affect progranulin function and production of mature granulins.

Frontotemporal Dementia due to the Novel GRN Arg161GlyfsX36 Mutation

Intrafamilial clinical phenotypic heterogeneity with progranulin gene p.Glu498fs mutation

Deficiency of the frontotemporal dementia gene GRN results in gangliosidosis

Frontotemporal Dementia Patient Neurons With Progranulin Deficiency Display Protein Dyshomeostasis

Diffusion tensor imaging for multilevel assessment of the visual pathway: possibilities for personalized outcome prediction in autoimmune disorders of the central nervous system

GRN mutation in a patient with a behavioral variant of frontotemporal lobar degeneration (bvFTD)

A cluster of progranulin C157KfsX97 mutations in Southern Italy: clinical characterization and genetic correlations

An Examination of the Associations between Life Problems and Psychiatric Disorders in a Rural Patient Population

Extensive white matter involvement in patients with frontotemporal lobar degeneration: think progranulin