Phosphorylation of tau in apolipoprotein E-deficient mice

I. Genis,I. Gordon,E. Sehayek,D. Michaelson

DOI: https://doi.org/10.1016/0304-3940(95)12007-Q

IF: 3.197

1995-10-13

Neuroscience Letters

Abstract:

What problem does this paper attempt to address?

Identification of LAMA2 Compound Heterozygous Variants: a Case Report

Yingchao Ying,Jia Ye,Jue Shen,Guojuan Chen,Kewen Jiang

DOI: https://doi.org/10.21037/tp-24-62

2024-01-01

Translational Pediatrics

Abstract:Background: Laminin-alpha 2 (LAMA2) chain- deficient muscular dystrophy (LAMA2-MD) is the most common congenital muscular dystrophy (CMD) in the world. Its main manifestations are muscle weakness and hypotonia that occur after birth or at early infancy. Case Description: We reported a case of a 3-year-old and 6-month-old boy presented with delayed motor development, elevated creatine kinase (CK) levels, and abnormal white matter in the brain. Whole exome sequencing (WES) showed compound heterozygous variants of the LAMA2 gene. This case reports for the first time the compound heterozygous LAMA2 variants c.5476C>T (p.R1826*) (paternal inheritance) with c.2749 + 2dup (maternal inheritance), as both variants are interpreted as pathogenic/potentially pathogenic variants. Conclusions: This study reports a novel heterozygous variant, including two pathogenic variants in the LAMA2 gene, and highlights the effectiveness of highly efficient exome sequencing applying in patients with undefined CMDs.
Case Report: Novel compound heterozygous variants in CHRNA1 gene leading to lethal multiple pterygium syndrome: A case report

Jianlong Zhuang,Junyu Wang,Qi Luo,Shuhong Zeng,Yu'e Chen,Yuying Jiang,Xinying Chen,Yuanbai Wang,Yingjun Xie,Gaoxiong Wang,Chunnuan Chen

DOI: https://doi.org/10.3389/fgene.2022.964098

2022-08-26

Abstract:Background: Lethal multiple pterygium syndrome (LMPS) is a rare autosomal recessive inherited disorder typically characterized by intrauterine growth retardation, multiple pterygia, and flexion contractures. Case presentation: We herein report a Chinese case with a history of three adverse pregnancies demonstrating the same ultrasonic phenotypes, including increased nuchal translucency, edema, fetal neck cystoma, reduced movement, joint contractures, and other congenital features. Whole-exome sequencing (WES) revealed novel compound heterozygous variants in the CHRNA1 gene NM_000079.4: c.[1128delG (p.Pro377LeufsTer10)]; [505T>C (p.Trp169Arg)] in the recruited individual, and subsequent familial segregation showed that both parents transmitted their respective mutation. Conclusion: For the first time, we identified an association between the CHRNA1 gene and the recurrent lethal multiple pterygium syndrome (LMPS) in a Chinese family. This finding may also enrich the mutation spectrum of the CHRNA1 gene and promote the applications of WES technology in etiologic diagnosis of ultrasound anomalies in prenatal examination.
Case Report: Early diagnosis of lethal multiple pterygium syndrome with micrognathia: Two novel mutations in the CHRND gene

Caiyuan Chen,Jin Han,Jiaxin Xue,Ru Li,Guilan Chen,Xin Yang,Jiajie Tang,Fucheng Li,Dongzhi Li

DOI: https://doi.org/10.3389/fgene.2023.1005624

2023-01-17

Abstract:Lethal multiple pterygium syndrome (LMPS) is a rare disease with genetic and phenotypic heterogeneity and is inherited in an autosomal recessive (AR) pattern. Here, we have presented clinically significant results describing two novel mutations of CHRND gene: NM_000751.2: c.1006C>T p.(Arg336Ter) and NM_000751.2:c.973_975delGTG p.(Val325del), and measurement of the facial angle for determining micrognathia by prenatal diagnosis in the first trimester of pregnancy for a Lethal multiple pterygium syndrome case. In conclusion, this report complements the spectrum of genetic variants and phenotype of Lethal multiple pterygium syndrome and provides reliable recommendation for the counseling of future pregnancies in families with the disease.
Lethal multiple pterygium syndrome, large cystic hygroma, and cleft palate: Rare and severe fetal presentations of RYR1‐ and NEB‐related congenital myopathies

Molly Jackson,Mary Ann Thomas,Ian Suchet,Houman Mahallati,Verena Kuret,Julie Lauzon

DOI: https://doi.org/10.1002/pd.6553

2024-03-25

Prenatal Diagnosis

Abstract:Congenital myopathies are a genetically heterogeneous group of neuromuscular disorders that commonly present with congenital hypotonia and weakness but can also present broadly. The most severe presentation is neonatal with arthrogryposis and, rarely, fetal akinesia and pterygia, features also seen in lethal multiple pterygium syndrome (LMPS). We describe two fetuses with similar phenotype, including hydrops fetalis, large cystic hygromas, bilateral talipes, and fetal akinesia in the second trimester. Genetic diagnoses were made using exome sequencing. Both fetuses had a severe form of congenital myopathy. In the first fetus, we identified two novel compound heterozygous likely pathogenic variants consistent with autosomal recessive RYR1‐related congenital myopathy (congenital myopathy 1B). In the second fetus, we identified two likely pathogenic variants, one of which is novel, likely in trans consistent with a diagnosis of autosomal recessive NEB‐related congenital myopathy. Reaching a genetic diagnosis for these fetuses allowed the families to receive accurate genetic counseling for future pregnancies. These fetuses highlight the genetic and phenotypic heterogeneity of LMPS, and support a broad approach to genetic testing.

genetics & heredity,obstetrics & gynecology
[Analysis of a case of Multiple pterygium syndrome due to a novel variant of CHRNG gene]

Yiru Chen,Tianying Nong,Weizhe Shi,Jiangui Li,Xuejiao Ding,Yue Li,Mingwei Zhu,Hongwen Xu

DOI: https://doi.org/10.3760/cma.j.cn511374-20220107-00009

2023-06-10

Abstract:Objective: To explore the clinical characteristics and genetic etiology of a child with multiple pterygium syndrome (MPS). Methods: A child with MPS who was treated at the Orthopedics Department of Guangzhou Women and Children's Medical Center Affiliated to Guangzhou Medical University on August 19, 2020 was selected as the study subject. Clinical data of the child was collected. Peripheral blood samples of the child and her parents were also collected. Whole exome sequencing (WES) was carried out for the child. Candidate variant was validated by Sanger sequencing of her parents and bioinformatic analysis. Results: The child, an 11-year-old female, had a complain of "scoliosis found 8 years before and aggravated with unequal shoulder height for 1 year". WES results revealed that she has carried a homozygous c.55+1G>C splice variant of the CHRNG gene, for which both of her parents were heterozygous carriers. By bioinformatic analysis, the c.55+1G>C variant has not been recorded by the CNKI, Wanfang data knowledge service platform and HGMG databases. Analysis with Multain online software suggested that the amino acid encoded by this site is highly conserved among various species. As predicted with the CRYP-SKIP online software, the probability of activation and skipping of the potential splice site in exon 1 caused by this variant is 0.30 and 0.70, respectively. The child was diagnosed with MPS. Conclusion: The CHRNG gene c.55+1G>C variant probably underlay the MPS in this patient.
Lethal multiple pterygium syndrome in a newborn, a case report

Parvaneh Sadeghimoghadam,Saeedeh Shirdel,Sedigheh Hantoushzadeh,Zeinab Hashemi,Marjan Ghaemi

DOI: https://doi.org/10.1002/ccr3.7678

2023-07-12

Abstract:Lethal multiple pterygium syndrome is a very rare genetic disorder. The manifestations of this condition include growth deficiency of the fetus, craniofacial anomalies, joint contracture, and skin webbing (pterygia). This disorder is fatal before birth or shortly after birth. We reported a case of lethal multiple pterygium syndrome with multiple anomalies including pterygia involving the axilla, bilateral antecubital fossa, and groin. Arthrogryposis involving multiple lower and upper extremities joints. Cleft palate, microstomia and limitation of mouth opening, webbed neck, asymmetric small and narrow chest, ambiguous genitalia, depressed and wide nasal bridge, antemongoloid slant, low-set, malformed, and posteriorly rotated ears, pterygia, syndactyly and camptodactyly of hands and rocket bottom feet. LMPS is a congenital genetic disease with multiple anomalies that is fatal in the second and third trimesters of pregnancy or shortly after birth. With genetic testing and counseling, it can be prevented from recurring in subsequent pregnancies.
Identification of a Likely Pathogenic Structural Variation in the LAMA1 Gene by Bionano Optical Mapping.

Min Chen,Min Zhang,Yeqing Qian,Yanmei Yang,Yixi Sun,Bei Liu,Liya Wang,Minyue Dong

DOI: https://doi.org/10.1038/s41525-020-0138-z

2020-01-01

npj Genomic Medicine

Abstract:Recent advances in Bionano optical mapping (BOM) provide a great insight into the determination of structural variants (SVs), but its utility in identification of clinical likely pathogenic variants needs to be further demonstrated and proved. In a family with two consecutive pregnancies affected with ventriculomegaly, a splicing likely pathogenic variant at the LAMA1 locus (NM_005559: c. 4663 + 1 G > C) inherited from the father was identified in the proband by whole-exome sequencing, and no other pathogenic variant associated with the clinical phenotypes was detected. SV analysis by BOM revealed an ~48 kb duplication at the LAMA1 locus in the maternal sample. Real-time quantitative PCR and Sanger sequencing further confirmed the duplication as c.859-153_4806 + 910dup. Based on these variants, we hypothesize that the fetuses have Poretti-Boltshauser syndrome (PBS) presenting with ventriculomegaly. With the ability to determine single nucleotide variants and SVs, the strategy adopted here might be useful to detect cases missed by current routine screening methods. In addition, our study may broaden the phenotypic spectrum of fetuses with PBS.
Identification of 11 Potentially Relevant Gene Mutations Involved in Growth Retardation, Intellectual Disability, Joint Contracture, and Hepatopathy

Hongyan Diao,Peng Zhu,Yong Dai,Wenbiao Chen

DOI: https://doi.org/10.1097/md.0000000000013117

IF: 1.6

2018-01-01

Medicine

Abstract:The multisystemic clinical characteristics of growth retardation, intellectual disability, joint contracture, and hepatopathy in humans are rare and there are no clear diagnoses of these conditions. However, previous studies using exome sequencing have suggested that they are caused by gene mutations, and some related pathogenic gene variants have been found. Here, we performed resequencing and genome-wide variation analysis of 3 individuals (an affected proband and unaffected parents) from a consanguineous family using Solexa sequencing technology to identify mutated genes. The following genetic features were identified: 3,586,775 single-nucleotide polymorphisms (SNPs), 583,416 insertion/deletion polymorphisms (InDels), and 8579 structural variations (SVs) in the genome of the father; 3,624,800 SNPs, 608,685 InDels, and 8,827 SVs in the genome of the mother; 3,574,431 SNPs, 571,196 InDels, and 8371 SVs in the genome of the proband. Variations between samples were determined by comparative analysis of authentic collections of SNPs and were functionally annotated. Variations in several important genes, including SEC22B, FLG, ZNF717, MUC4, TRIL, CTAGE4, FOXG1, LOC100287399, KRTAP1-3, and LRRC37A3, were surveyed by alignment analysis. The results present new evidence that mutations in 11 genes may be associated with characteristic clinical growth retardation, intellectual disability, joint contracture, and hepatopathy.
Prenatal Diagnosis of PPP2R1A-Related Neurodevelopmental Disorders Using Whole Exome Sequencing: Clinical Report and Review of Literature

Tingying Lei,Li Zhen,Xin Yang,Min Pan,Fang Fu,Jin Han,Lushan Li,Dongzhi Li,Can Liao

DOI: https://doi.org/10.3390/genes14010126

IF: 4.141

2023-01-03

Genes

Abstract:PPP2R1A-related neurodevelopmental disorder (NDD) is expressed with autosomal dominant inheritance and is typically caused by a pathogenic de novo PPP2R1A mutation. It is characterized by the predominant features of hypotonia, developmental delay, moderate-to-severe intellectual disability, agenesis of corpus callosum (ACC), ventriculomegaly, and dysmorphic features; however, none of these anomalies have been diagnosed prenatally. We report on the prenatal diagnosis of PPP2R1A-related NDD in two fetuses by whole exome sequencing. Fetus 1 had partial ACC and severe lateral ventriculomegaly; the pathogenic heterozygous c.544C > T (p. Arg182Trp) de novo missense variant in PPP2R1A was detected. Fetus 2 had severe enlargement of the lateral and third ventricles and macrocephaly; they showed a heterozygous likely pathogenic mutation in PPP2R1A gene (c.547C > T, p. Arg183Trp). Both variants were de novo. This was the first study to use trio WES to prenatally analyze fetuses with PPP2R1A variants. Prenatal diagnosis will not only expand the fetal phenotype of this rare genetic condition but also allow for an appropriate counseling of prospective parents regarding pregnancy outcomes.

genetics & heredity
Effect of clinical whole exome sequencing in aetiological investigation and reproductive risk prediction for a couple with monogenic inherited diseases

Yanan Wang,Yuqiong Chai,Jieqiong Wang,Mingya Gao,Weiwei Zang,Yujie Chang

DOI: https://doi.org/10.3389/fgene.2024.1364769

IF: 3.7

2024-05-30

Frontiers in Genetics

Abstract:Objective: To determine the genetic causes of monogenic inherited diseases in a couple using clinical whole exome sequencing (WES) and advise on their reproductive choices. Methods: WES was applied to a couple seeking reproductive advice, the female with short stature and the male with congenital cataracts. Results: (1) The woman exhibited a 13.8 Kb heterozygous deletion at chrX: 591590–605428 (hg19). This region corresponds to exons 2–6 of the short-stature homeobox-containing ( SHOX ) gene (NM000451). Associated diseases involving the SHOX gene range from severe Leri–Weill dyschondrosteosis to mild nonspecific short stature. Meanwhile, further validation using a quantitative reverse transcription polymerase chain reaction assay confirmed the heterozygous deletion of the SHOX gene in the proband, as well as other family members with similar clinical characteristics (the proband's mother, aunt, and cousin). Multiple pathogenic reports of this variant have been included in the HGMD database. Per the American College of Medical Genetics and Genomics (ACMG) classification criteria, this deletion is classified as pathogenic. (2) For the male patient, a heterozygous variant was detected in the CRYBB3 gene: NM004076: c.226G>A (p.Gly76R). Variants in the CRYBB3 gene can cause Cataract 22 (OMIM: 609741). At present, this variant locus is not included in databases such as the gnomAD, while both SIFT and PolyPhen2 deem this locus 'damaging'. Moreover, further validation by Sanger sequencing confirmed that the variant was inherited from the male patient's mother, who also had cataracts. According to ACMG standards and guidelines, the c.226G>A (p.Gly76Arg) variant in the CRYBB3 gene is classified as having 'uncertain significance'. Conclusion: WES identified pathogenic variants in both individuals, suggesting a 25% chance of a healthy child naturally. Third-generation assisted reproductive techniques are recommended to minimize the risk of affected offspring.

genetics & heredity
Importance and application of WES in fetal genetic diagnostics: Identification of novel ASPM mutation in a fetus with microcephaly

Renata Szalai,Agnes Till,Attila Gyenesei,Judit Bene,Kinga Hadzsiev

DOI: https://doi.org/10.1016/j.ymgmr.2024.101056

IF: 2.082

2024-01-19

Molecular Genetics and Metabolism Reports

Abstract:Background Prenatal whole exome sequencing (WES) approaches can provide genetic diagnosis with rapid turnaround time and high diagnostic rate when conventional tests are negative. Here we report a family with multiple pregnancy loss and with repeated occurrence of fetal microcephaly. Methods and results Because of positive family history and recurrent structural abnormality during the pregnancies that may lead postnatal neurodevelopmental consequences, WES analysis was indicated. Umbilical cord blood sampling was carried out and WES was performed using Twist Human Core Exome Kit and Illumina sequencing technology. The presence of pathogenic variants was confirmed by Sanger sequencing. WES analysis revealed a known pathogenic c.8506_8507delCA (p.Gln2836Glufs*35, rs587783280) and a novel pathogenic c.3134_3135delTC (p.Leu1045Glnfs*17) ASPM mutations in the fetus in compound heterozygous state. The c.3134_3135delTC has never been reported in the literature. Conclusions Our findings serve additional evidence that WES can be an efficient and relevant tool to diagnose certain genetic disorders with appropriate indication and to assess the recurrence risk of a disease. With the application of WES in combination with pre-implantation genetic tests, we can avoid the transmission of pathogenic mutations and we can achieve a decreased abortion rate in obstetric care.

genetics & heredity
Diagnostic Yield of Whole Exome Data in Fetuses Aborted for Conotruncal Malformations

Jia-wei Shi,Haiyan Cao,Liu Hong,Jing Ma,Li Cui,Yi Zhang,Xiaoyan Song,Juanjuan Liu,Yali Yang,Qing Lv,Li Zhang,Jing Wang,Mingxing Xie

DOI: https://doi.org/10.1002/pd.6147

2022-01-01

Prenatal Diagnosis

Abstract:Objective We investigated a custom congenital heart disease (CHD) geneset to assess the diagnostic value of whole-exome sequencing (WES) in karyotype- and copy number variation (CNV)-negative aborted fetuses with conotruncal defects (CTDs), and to explore the impact of postnatal phenotyping on genetic diagnosis. Methods We sequentially analyzed CNV-seq and WES data from 47 CTD fetuses detected by prenatal ultrasonography. Fetuses with either a confirmed aneuploidy or pathogenic CNV were excluded from the WES analyses, which were performed following the American College of Medical Genetics and Genomics recommendations and a custom CHD-geneset. Imaging and autopsy were applied to obtain postnatal phenotypic information about aborted fetuses. Results CNV-seq identified aneuploidy in 7/47 cases while 13/47 fetuses were CNV-positive. Eighty-five rare deleterious variants in 61 genes (from custom geneset) were identified by WES in the remaining 27 fetuses. Of these, five pathogenic or likely pathogenic variants (PV/LPV) were identified in five fetuses, revealing a 10.6% (5/47) incremental diagnostic yield. Furthermore, RERE:c.2461_2472delGGGATGTGGCGA was reclassified as LPV based on postnatal phenotypic data. Conclusion We have developed and defined a CHD gene panel that can be utilized in a subset of fetuses with CTDs. We demonstrate the utility of incorporating both prenatal and postnatal phenotypic information may facilitate WES diagnostics.
Clinical Features and Genetic Analysis of Early-Onset Epileptic Encephalopathy with Pachygyria-Lissencephaly

Hu Chunhui,Sun Dan,Deng Xiaolong,Hu Jiasheng,Liu Zhisheng

DOI: https://doi.org/10.3760/cma.j.issn.2095-428x.2018.24.006

2018-01-01

Abstract:Objective To study the clinical phenotype and prognosis of children diagnosed with early-onset epileptic encephalopathy (EOEE) and pachygyria-lissencephaly,and to explore the potential genetic factors.Methods The clinical data of 65 children between December 2005 and December 2016 was obtained and analyzed.And the whole exome sequencing was analyzed by using second generation sequencing technology.Results Among 65 children,17 cases (26.1％) were diagnosed as lissencephaly,34 cases (52.3 ％) were pachygyria,and 14 cases (62.6％)were pachygyria with lissencephaly.Thirteen cases (20.0％) were infantile spasms,9 cases (13.8％) were ohtahara syndrome,3 cases (4.6％) were early myoclonic epileptic encephalopathy,and 40 cases (61.6％) were non-symptomatic EOEE.Six cases (6/65 cases,9.2％) were associated with dyskinesia,of whom 3 cases showed dystonia,2 cases of limb tremor,1 case of dancing-like movements.Electroencephalophalogram (EEG) showed serious multifocal discharge,40 cases had massive multifocal discharge.Brain images showed that simple pachygyria was more common (34/65 cases,52.3 ％).Among them,focal pachygyria was more common (25/34 cases,73.5 ％),mostly involving in the frontoparietal lobe (11/25 cases,44.0％).Copy number variations and whole exon sequencing were performed on 61 patients.Copy number variation was detected in 1 patient.There were 2 cases of lissencephaly-1/platelet-activating factor acetylhydrolase isoform 1B (LIS1/PAFAH1B1) mutation,1 case of syntaxin-blinding protein 1 (STXBP1)mutation,1 case of Aristaless-related homeobox (ARX) mutation,and 1 case of dynein cytoplasmic 1 heavy chain 1(DYNC1H1) mutation.The follow-up time varied from 1 year to 8 years [(3.5 ± 1.4) years],in which 20 cases had clinical seizures under control but 45 cases out of control.Conclusion Infantile spasms and non-syndromic EOEEare more common in children diagnosed with EOEE and pachygyria-lissencephaly.A small number of cases have dyskinesia.EEG shows serious abnormalities,mostly multifocal discharge.Brain images show simple pachygyria is more common,mostly involving in the frontoparietal lobe.Common gene mutations are LIS1/PAFAH1B1,STXBP1,ARX.Gene mutations can lead to both clinical manifestations of cortical deformity and EOEE,and genetic factors play an important role in children with brain developmental deformity and epilepsy.
[Genetic testing and prenatal diagnosis for a Chinese pedigree affected with Meckel-Gruber syndrome]

Zhihui Jiao,Ganye Zhao,Lina Liu,Yu Guo,Xiangdong Kong

DOI: https://doi.org/10.3760/cma.j.cn511374-20200606-00413

2021-12-10

Abstract:Objective: To carry out genetic testing and prenatal diagnosis for a Chinese couple whom had conceived two fetuses featuring multiple malformations including polycystic kidney, polydactyly and encephalocele. Methods: Following elective abortion, the fetus from the second pregnancy was subjected to whole exome sequencing. Suspected pathogenic variants were verified by Sanger sequencing of the fetus and its parents. Results: The fetus was found to harbor compound heterozygous variants of the CEP290 gene, namely c.2743G>T (p.E915X) and c.2587-2A>T, which were respectively inherited from its father and mother. The same variants were not detected among 100 healthy controls nor reported previously. Bioinformatic analysis suggested both variants to be deleterious. The fetus was diagnosed with Meckel-Gruber syndrome. Prenatal diagnosis for the couple during their next pregnancy suggested that the fetus did not carry the above pathogenic variants. Conclusion: The compound heterozygous variants of the CEP290 gene probably underlay the pathogenesis of Meckel-Gruber syndrome in the second fetus. Above finding has provided a basis for genetic counseling and prenatal diagnosis for the couple, and also enriched the mutational spectrum of the CEP290 gene.
Homozygous PLCB1 deletion associated with malignant migrating partial seizures in infancy.

Annapurna Poduri,Sameer S Chopra,Edward G Neilan,P Christina Elhosary,Manju A Kurian,Esther Meyer,Brenda J Barry,Omar S Khwaja,Mustafa A M Salih,Tommy Stödberg,Ingrid E Scheffer,Eamonn R Maher,Mustafa Sahin,Bai-Lin Wu,Gerard T Berry,Christopher A Walsh,Jonathan Picker,Sanjeev V Kothare

DOI: https://doi.org/10.1111/j.1528-1167.2012.03538.x

IF: 6.74

2012-01-01

Epilepsia

Abstract:Malignant migrating partial seizures in infancy (MMPEI) is an early onset epileptic encephalopathy with few known etiologies. We sought to identify a novel cause of MMPEI in a child with MMPEI whose healthy parents were consanguineous. We used array comparative genomic hybridization (CGH) to identify copy number variants genome-wide and long-range polymerase chain reaction to further delineate the breakpoints of a deletion found by CGH. The proband had an inherited homozygous deletion of chromosome 20p13, disrupting the promoter region and first three coding exons of the gene PLCB1. Additional MMPEI cases were screened for similar deletions or mutations in PLCB1 but did not harbor mutations. Our results suggest that loss of PLC beta 1 function is one cause of MMPEI, consistent with prior studies in a Plcb1 knockout mouse model that develops early onset epilepsy. We provide novel insight into the molecular mechanisms underlying MMPEI and further implicate PLCB1 as a candidate gene for severe childhood epilepsies. This work highlights the importance of pursuing genetic etiologies for severe early onset epilepsy syndromes.
Spontaneous subarachnoid haemorrhage and its therapeutic problems.

L. F. Levy

East African Medical Journal

Abstract:
The Clinical and Genotypic Spectrum of Scoliosis in Multiple Pterygium Syndrome: A Case Series on 12 Children

Noémi Dahan-Oliel,Klaus Dieterich,Frank Rauch,Ghalib Bardai,Taylor N Blondell,Anxhela Gjyshi Gustafson,Reggie Hamdy,Xenia Latypova,Kamran Shazand,Philip F Giampietro,Harold van Bosse

DOI: https://doi.org/10.3390/genes12081220

2021-08-06

Abstract:Background: Multiple pterygium syndrome (MPS) is a genetically heterogeneous rare form of arthrogryposis multiplex congenita characterized by joint contractures and webbing or pterygia, as well as distinctive facial features related to diminished fetal movement. It is divided into prenatally lethal (LMPS, MIM253290) and nonlethal (Escobar variant MPS, MIM 265000) types. Developmental spine deformities are common, may present early and progress rapidly, requiring regular fo llow-up and orthopedic management. Methods: Retrospective chart review and prospective data collection were conducted at three hospital centers. Molecular diagnosis was confirmed with whole exome or whole genome sequencing. Results: This case series describes the clinical features and scoliosis treatment on 12 patients from 11 unrelated families. A molecular diagnosis was confirmed in seven; two with MYH3 variants and five with CHRNG. Scoliosis was present in all but our youngest patient. The remaining 11 patients spanned the spectrum between mild (curve ≤ 25°) and malignant scoliosis (≥50° curve before 4 years of age); the two patients with MYH3 mutations presented with malignant scoliosis. Bracing and serial spine casting appear to be beneficial for a few years; non-fusion spinal instrumentation may be needed to modulate more severe curves during growth and spontaneous spine fusions may occur in those cases. Conclusions: Molecular diagnosis and careful monitoring of the spine is needed in children with MPS.
Prenatal Diagnosis of Two Families with Megalencephalic Leukoencephalopathy with Subcortical Cysts

Cao Binbin,Yan Huifang,Xie Han,Guo Mangmang,Wu Ye,Yang Huixia,Pan Hong,Chen Junya,Sun Yu,Wu Xiru,Jiang Yuwu,Wang Jingmin

DOI: https://doi.org/10.3760/cma.j.issn.1007-9408.2017.03.005

2017-01-01

Abstract:Objectives To provide genetic counseling and prenatal molecular diagnosis for two families with megalencephalic leukoencephalopathy with subcortical cysts (MLC).Methods Two MLC patients (probands 1 and 2) were admitted to the Department of Pediatrics of Peking University First Hospital in June 2011 and June 2009,respectively.Peripheral blood was collected and DNA sequencing was performed for genetic analysis for the two MLC patients and their parents.Amniotic fluid and villus of two fetuses (fetus 1 and 2) were collected at 21+4 and 12+3 weeks of gestational age from their mothers when they were pregnant again.The genomic DNA of the two fetuses was extracted and corresponding sites of MLC1 gene were sequenced.Haplotype analysis using a combination of 3 microsatellite markers (AR,DXS6807 and DXS6797) on chromosome X and sex determining region of Y chromosome was performed to detect maternal cell contamination.Verification of the prenatal molecular diagnosis and follow up study after birth were conducted for both fetuses.Results Macrocephaly,motor development delay and typical findings on brain MRI were identified in the two probands,and were clinically diagnosed with MLC.Compound heterozygous mutations were detected in proband 1 [c.353C＞T (p.T118M) and c.803C＞G (p.T268R)] and proband 2 [c.353C＞T (p.T118M) and c.836T＞C(p.L279P)],respectively.MLC was genetically diagnosed.Heterozygous variation in c.353[c.353C＞T (p.T118M)] and wild c.803C were identified in fetus 1,and both wild c.353C and c.836T were found in fetus 2.No maternal cell contamination was detected in both fetuses.Sequencing the corresponding sites after birth confirmed the prenatal diagnosis,and the head circumference and motor development were normal in fetus 1 at 5 months old.No macrocephaly was found and no DNA sequencing was done in fetus 2 at one month old.Conclusions Genetic counseling and prenatal molecular diagnosis for MLC families combined with clinical and genetic diagnosis are important in preventing MLC.Haplotype analysis with a combination of three microsatellite markers on chromosome X and sex determining region of Y chromosome is useful in detecting maternal cell contamination and avoiding its influence on prenatal diagnosis,and confirming the reliability of prenatal diagnosis.
[A crisis of peroperative angina. After nasal spraying with a 10% solution of neosynephrine during dacryocystorhinostomy].

D. Brasdefer,D. Cantineau,F. Thibaut,M. Niset,P. Scherpereel

1988-03-01

Abstract:
Identification of genetic polymorphisms in unexplained recurrent spontaneous abortion based on whole exome sequencing

Jiang-Tao Mou,Shi-Xing Huang,Li-Li Yu,Jing Xu,Qiao-Ling Deng,Yi-Shan Xie,Kun Deng

DOI: https://doi.org/10.21037/atm-22-2179

IF: 3.616

2022-05-27

Annals of Translational Medicine

Abstract:Background: The precise etiology of approximately 50% of patients with recurrent spontaneous abortion (RSA) is unclear, known as unexplained recurrent spontaneous abortion (URSA). This study identified the genetic polymorphisms in patients with URSA.Methods: Genomic DNA was extracted from 30 couples with URSA and 9 couples with normal reproductive history for whole exome sequencing. Variations in annotation, filtering, and prediction of harmfulness and pathogenicity were examined. Furthermore, predictions of the effects of changes in protein structure, Sanger validation, and functional enrichment analyses were performed. The missense mutated genes with significant changes in protein function, and genes with mutations of premature stop, splice site, frameshift, and in-frame indel were selected as candidate mutated genes related to URSA.Results: In 30 unrelated couples with URSA, 50%, 20%, and 30% had 2, 3, and more than 4 miscarriages, respectively. Totally, 971 maternal and 954 paternal mutations were found to be pathogenic or possibly pathogenic after preliminary filtering. Total variations were not associated with age nor the number of miscarriages. In 28 patients (involving 23 couples), 22 pathogenic or possibly pathogenic variants of 19 genes were found to be strongly associated with URSA, with an abnormality rate of 76.67%. Among these, 12 missense variants showed obvious changes in protein functions, including ANXA5 (c.949G>C; p.G317R), APP (c.1530G>C; p.K510N), DNMT1 (c.2626G>A; p.G876R), FN1 (c.5621T>C; p.M1874T), MSH2 (c.1168G>A; p.L390F), THBS1 (c.2099A>G; p.N700S), KDR (c.2440G>A; p.D814N), POLR2B (c.406G>T; p.G136C), ITGB1 (c.655T>C; p.Y219H), PLK1 (c.1210G>T; p.A404S), COL4A2 (c.4808 A>C; p.H1603P), and LAMA4 (c.3158A>G; p.D1053G). Six other genes with mutations of premature stop, splice site, frameshift, and in-frame indel were also identified, including BUB1B (c.1648C>T; p.R550*) and MMP2 (c.1462_1464delTTC; p.F488del) from the father, and mutations from mother and/or father including BPTF (c.396_398delGGA; p.E138 del and c.429_431GGA; p.E148del), MECP2 (c.21_23delCGC; p.A7del), LAMA2 (HGVS: NA; Exon: NA; SPLICE_SITE, DONOR), and SOX21 (c.640 _641insT; p. A214fs, c.644dupC; p. A215fs and c.644_645ins ACGCGTCTTCTTCCCGCAGTC; p. A215dup).Conclusions: These pathogenic or potentially pathogenic mutated genes may be potential biomarkers for URSA and may play an auxiliary role in the treatment of URSA.

oncology,medicine, research & experimental

Phosphorylation of tau in apolipoprotein E-deficient mice

Identification of LAMA2 Compound Heterozygous Variants: a Case Report

Case Report: Novel compound heterozygous variants in CHRNA1 gene leading to lethal multiple pterygium syndrome: A case report

Case Report: Early diagnosis of lethal multiple pterygium syndrome with micrognathia: Two novel mutations in the CHRND gene

Lethal multiple pterygium syndrome, large cystic hygroma, and cleft palate: Rare and severe fetal presentations of RYR1‐ and NEB‐related congenital myopathies

[Analysis of a case of Multiple pterygium syndrome due to a novel variant of CHRNG gene]

Lethal multiple pterygium syndrome in a newborn, a case report

Identification of a Likely Pathogenic Structural Variation in the LAMA1 Gene by Bionano Optical Mapping.

Identification of 11 Potentially Relevant Gene Mutations Involved in Growth Retardation, Intellectual Disability, Joint Contracture, and Hepatopathy

Prenatal Diagnosis of PPP2R1A-Related Neurodevelopmental Disorders Using Whole Exome Sequencing: Clinical Report and Review of Literature

Effect of clinical whole exome sequencing in aetiological investigation and reproductive risk prediction for a couple with monogenic inherited diseases

Importance and application of WES in fetal genetic diagnostics: Identification of novel ASPM mutation in a fetus with microcephaly

Diagnostic Yield of Whole Exome Data in Fetuses Aborted for Conotruncal Malformations

Clinical Features and Genetic Analysis of Early-Onset Epileptic Encephalopathy with Pachygyria-Lissencephaly

[Genetic testing and prenatal diagnosis for a Chinese pedigree affected with Meckel-Gruber syndrome]

Homozygous PLCB1 deletion associated with malignant migrating partial seizures in infancy.

Spontaneous subarachnoid haemorrhage and its therapeutic problems.

The Clinical and Genotypic Spectrum of Scoliosis in Multiple Pterygium Syndrome: A Case Series on 12 Children

Prenatal Diagnosis of Two Families with Megalencephalic Leukoencephalopathy with Subcortical Cysts

[A crisis of peroperative angina. After nasal spraying with a 10% solution of neosynephrine during dacryocystorhinostomy].

Identification of genetic polymorphisms in unexplained recurrent spontaneous abortion based on whole exome sequencing