The nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.

F. Takaiwa,M. Kusuda,N. Saga,M. Sugiura
DOI: https://doi.org/10.1093/NAR/10.19.6037
IF: 14.9
1982-10-11
Nucleic Acids Research
Abstract:The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).
What problem does this paper attempt to address?