Lack of Association Between Common UGT2B Nonsynonymous Single‐nucleotide Polymorphisms and Breast Cancer in Populations of African Ancestry
Chang Sun,Dezheng Huo,Barbara Nemesure,Anselm Hennis,M. Cristina Leske,Suh‐Yuh Wu,Qun Niu,Olufunmilayo I. Olopade,Anna Di Rienzo
DOI: https://doi.org/10.1002/ijc.26300
2011-01-01
International Journal of Cancer
Abstract:Breast cancer is the most common cancer in women, and cumulative estrogen exposure over a life time is the major risk factor.1 Therefore, the steroid hormone metabolizing enzymes have been proposed to play an important role in breast cancer risk.2 Among these enzymes are UDP-glucuronosyltransferases (UGTs), which can transfer glucuronic acid from UDP-glucuronic acid to substrates, thus making them more water soluble than their parent compound and more easily excreted through the biliary and renal systems.3 In humans, there are two major UGT subfamilies, UGT1A and UGT2B, the latter of which includes seven active members (UGT2B4, UGT2B7, UGT2B10, UGT2B11, UGT2B15, UGT2B17 and UGT2B28) located on chromosome 4.4 The most important members of this family are UGT2B7 and UGT2B15, which have high activity on steroid hormone5 and high expression level in liver.3 In these two genes, multiple nonsynonymous single-nucleotide polymorphisms (SNPs), such as D85Y (rs1902023) and T523K (rs4148269) in UGT2B15, and H268Y (rs7439366) in UGT2B7, have been verified to alter the enzyme activity significantly and are common in human populations.3 Therefore, these SNPs might contribute to breast cancer risk, but their association was still not clear. To address this issue, we collected 274, 139 and 874 breast cancer patients and 102, 331 and 418 women without breast cancer from the United States, Barbados and Nigeria, respectively, all of which were of African ancestry. The demographics and environmental risk factor information for these populations could be found in our recent publication.6 The three SNPs, rs1902023, rs4148269 and rs7439366, were genotyped by commercial TaqMan assays C_27028164_10, C_9440184_20 and a custom TaqMan assay (primers GGAAAGCTGACGTATG GCTTATT and AAAGCCAACAAAATAAAACCAACA and probes 6FAM-TCAGTTTCCTCATCCAC and VIC-TCAGTT TCCATATCCAC; target in bold; Applied Biosystems, Foster City, CA), respectively, according to the manufacturer's protocol. Hardy–Weinberg equilibrium (HWE) was tested using a Chi-square test with one degree of freedom in cases and controls for three populations separately. The genotype frequencies in patients and controls were compared by Chi-square tests, followed by logistic regression to estimate odds ratios and 95% confidence intervals (CI). Because of allele frequency difference across populations, the logistic regression adjusted an indicator variable for population. All statistical tests were performed in Stata 11.0 (StataCorp LP, College Station, TX), and a p < 0.05 was considered statistically significant. The genotype counts and comparisons between cases and controls for each SNP were listed in Table 1. No deviation from HWE was observed (p > 0.05) in any of the three populations (result not shown) for all SNPs. For rs1902023, the allele frequency was ∼34, ∼48 and ∼18% for G/G, G/T and T/T genotype, respectively (Table 1), which was consistent among the three populations surveyed and was close to the published value for African populations.7 No significant difference in allele frequency between cases and controls was observed in any of the populations (p > 0.44 in all populations, Table 1). Similar results were obtained for other two SNPs (Table 1). There are multiple possible explanations for these results. One is that the change in enzyme activity resulting from the amino acid substitution is not large enough to influence steroid hormone levels in the human body. Alternatively, nearby regulatory SNPs in linkage disequilibrium (LD) with the nonsynonymous ones may compensate for the activity differences due to the amino acid change. For example, 85Y allele of UGT2B15 shows almost twice the enzyme activity as 85D,3 but it is in nearly complete LD with a relatively low activity promoter.7 As a consequence, the total glucuronidation activity for UGT2B15 might still be similar between the two haplotypes. This was also observed for two other nonsynonymous SNPs,8-10 highlighting the importance of considering the functional effect of the haplotype instead of single SNPs. Another possibility is that we do not have sufficient power to detect an association; however, the effect of the variation on breast cancer risk would have to be quite low. Chang Sun*, Dezheng Huo , Barbara Nemesure , Anselm Hennis §, M. Cristina Leske , Suh-Yuh Wu , Qun Niu¶, Olufunmilayo I. Olopade¶, Anna Di Rienzo*, * Department of Human Genetics, University of Chicago, Chicago, IL, Department of Health Studies, University of Chicago, Chicago, IL, Department of Preventive Medicine, State University of New York at Stony Brook, Stony Brook, NY, § Chronic Disease Research Centre, Tropical Medicine Research Institute and Faculty of Medical Sciences, The University of the West Indies, Bridgetown, Barbados, ¶ Department of Medicine, University of Chicago, Chicago, IL.