Tissue-specific and constitutive a-tubulin genes of Drosophila melanogaster code for structurally distinct proteins ( gene family )
W. Theurkauf,H. Baum,J. Bo,P. C. Wensink
Abstract:We have determined the nucleotide sequences of all four Drosophila a-tubulin genes (al, a2, a3, and a4). Two of the genes, al and a3, are constitutively expressed and code for proteins that are very similar to previously sequenced a-tubulins. They differ from each other by only two amino acid substitutions. These two genes also have blocks of homology between the noncoding leader regions of their transcription units. In contrast to these constitutive genes, the tissue-specific a2 and a4 genes code for tubulins with different structures. The a2 mRNA is male-specific in adults and codes for a tubulin that differs from al at 21 of the 450 residues. Six nonconservative substitutions are clustered within the 14 carboxyl-terminal amino acids, a region implicated in the regulation of microtubule assembly. The a4 mRNA is maternal and is found only in ovarian nurse cells, eggs, and early embryos. It codes for the most highly divergent a-tubulin yet reported and differs from al at 149 positions. Microtubules are the major structural elements of cilia, flagella, the cytoskeleton, and the mitotic and meiotic spindles. As might be expected from their presence in these structures, the disruption of normal microtubule assembly affects cell motility, division, and secretion, as well as intracellular transport (reviewed in ref. 1). This diversity in microtubular structure and function suggests that different microtubule subunits assemble into specialized microtubules (2). The basic subunit of all microtubules is a heterodimer of aand ,8-tubulin polypeptides. This a/3 subunit coassembles with speciesand tissue-specific microtubule-associated proteins (MAPs) (3) to form microtubules in vivo. Thus, functional specialization should be reflected in the structures of the aand f-tubulins, the MAPs, or both. Studies of tubulin proteins and genes from a wide variety of species indicate that although tubulin structure is highly conserved among species, there is some minor variation between the tubulins found in a single organism. This variation is due to both posttranslational modification of the tubulin heterodimer (4, 5) and primary-structure differences encoded in multiple tubulin genes (reviewed in ref. 6). The degree to which primary-structure differences contribute to tubulin heterogeneity is only beginning to emerge, because complete sequence analysis of an entire tubulin gene family of a higher eukaryote has not been reported. The available sequence data indicate that multiple tubulin genes do code for structurally different tubulins. For example, among the known sequences of chicken 3-tubulins the greatest difference is 8.7%. This clearly represents a minimum estimate of the range of differences in a single organism because only four of the nine or more ,B-tubulin genes from chicken have been analyzed. The sequences of all the aor P-tubulin genes from a higher eukaryote would indicate the entire range of tubulin primary structures utilized by the organism and facilitate molecular approaches to the study of tubulin specialization. In this paper we describe the sequence of the entire a-tubulin gene family of the higher eukaryote Drosophila melanogaster. There are four a-tubulin genes in Drosophila, referred to as al, a2, a3, and a4,t at chromosomal locations 84B3-6, 85E6-10, 84D4-8, and 67C4-6, respectively (8). The al and a3 genes appear to be constitutively expressed, whereas the other two genes have highly specialized developmental patterns of expression (9-11). In adults, a2 transcripts are found only in males, where they may be testes-specific (9). The a4 transcripts accumulate only in very early embryos and in adult female ovaries (9). In situ hybridization to ovarian tissue indicates that the a4 message is maternal and is synthesized in the nurse cells (M. Harris and P.C.W., unpublished data). This suggests that al and a3 may have functions, such as providing cytoskeletal structure, that are common to most cells, whereas a2 and a4 may provide tubulins with specialized functions. In this paper we report the complete nucleotide sequences and the transcript maps of all four Drosophila a-tubulin genes. The constitutively and coordinately expressed al and a3 genes code for nearly identical proteins that are very similar to the known sequences of a-tubulins from other species. The two sex-specific a-tubulin genes, a2 and a4, code for quite different polypeptides that may be functionally specialized. MATERIALS AND METHODS Sequencing. DNA fragments containing Drosophila atubulin genes were excised from plasmids pDmTal-4 (8, 12) and subcloned into plasmids pUC8 and pUC9 for sequence analysis. A series of deletions in the pUC subclones were prepared using the DNase I method of Hong (13), modified for use with double-stranded plasmid DNA. Plasmid DNA was prepared by the alkaline-lysis method (14). Deletions were sized by gel electrophoresis rather than by the sequencing protocol of Hong. Single-stranded templates for dideoxy sequencing (15) were prepared by digesting plasmid DNA with a restriction endonuclease that cut within 2.0 kilobases downstream (relative to the direction of primer extension) of the primer site. The DNA was then precipitated with ethanol, washed in 70% (vol/vol) ethanol, dried, and resuspended in 50 ,ul of 70 mM Tris HCl, pH 8.0/1 mM MgCl2/10 mM dithiothreitol. This DNA was digested (16) with 25 units of exonuclease III at 37°C for 3 hr or at 25°C overnight. Digestions were terminated and protein was removed by three extractions Abbreviation: MAPs, microtubule-associated proteins. *To whom reprint requests should be addressed. tRecommended symbols (7) for these genes are aTub84B, aTub85E, aTub84D, and aTub67C. 8477 The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact. 8478 Biochemistry: Theurkauf et al. with phenol/chloroform (1:1). This DNA was precipitated, washed, and dried as above and then resuspended in 15 1.l of 10 mM Tris-HCl, pH 8.0/1 mM EDTA. The resuspended templates were sequenced by the dideoxy procedure (15), but using 32P-end-labeled primer (universal sequencing primer, New England Biolabs). End-labeled primer was essential for generating unambiguous sequence data from these templates. Products of the reactions were electrophoresed in 6% polyacrylamide buffer-gradient sequencing gels (17). Other Methods. DNA restriction fragments were radiolabeled using either bacteriophage T4 polynucleotide kinase or avian myeloblastosis virus reverse transcriptase as described (18). RNA isolation, plasmid purification, agarose gel electrophoresis, ligations, and bacterial transformations were done as described (14, 19). Restriction endonucleases and other DNA-modifying enzymes were purchased from Proc. Natl. Acad. Sci. USA 83 (1986) $oehringer Mannheim and New England Biolabs. Radiolabeled nucleotides were obtained from ICN. RESULTS AND DISCUSSION Nucleotide Sequence and Transcript Maps of the Drosophila a-Tubuin Genes. The strategy of Hong (13), adapted for use with double-stranded plasmid vectors (see Materials and Mfethods), was used to generate deletions in subcloned fragments of the four a-tubulin genes. DNA neighboring the deletion breakpoints was then sequenced by the dideoxy method (15), resulting in the sequences shown in Figs. 1 and 2. The intron/exon structures of the four genes are shown in Figs. 1 and 2. The structures of al, a2, and a4 are similar. The first exon of each encodes only the first amino acid of the protein. In each case the codon for the first amino acid is located within a consensus splice-donor sequence and the GTCGACAGCTTGCCGTCTCTAGCTCCGGTGCCTATATAAAGCAGCCCGCTTTCCACATTTCATATTCGTTT-TACGTTTGTCAAGccTcATAGccGGCAGTTCGAAC +45 GTGAGTA +150 CTTTAAAAAAAAATCTAGTGAAATAATGCTGAAAAGAAATTTGTGTGGGCAAAATTCAATGGGCAAAAACGCGATGCGGCTTTTTCTCAAAATGGCGGCCGGCCTG +25 5 CGTTTTTTCCTCAAAAGTGATGACGTCATGCCTGTTTTTTTTTTTTTTGTTCGCAATGAGGAATGGCTCTTAAAATCTAGATAAAAAAAATATTCATTATTTCTAT +360 GCTGCTGGAACGCTTCATTAATCTTAAAAATTCTAAATTCGGTTACCATGATACTTCGACGCATAACTGTAGATTTTGGATAGAATTAAAGAGAAAATGGCGAGAG +46 5 AGTAAAATTCCGGCGTCGGCAAAGTAGAGCAAAAAAATCAGTATACCATTTAGCTACCTCTCTCACTCGCACGCAGTGCCGGCTCAAGTTGGGCGCGGCTCTGCAA + 57 0 TTATCGATTTTCTTGGGGTGTGTAACTAATCATCCGTTTTCCCTTCCTCCTCATCCACAGCGTGAATGTATC-TCTATCCATGTTGGTCAGGCTGGTGTCCAGATTG + 67 5 GAAACGCCTGCTGGGAGCTCTACTGCTTGGAGCACGGCATCCAGCCCGATGGCCAGATG('CGTC-TGACAAGACCGTGGCGrrGAGGTGATGACTCGTTCAACACCTT +78 0 CTTCAGCGAGACTGGAGCTGG-CAAGCACGTGCCCCGCGCCGTGT TTGTGGATCTGGAACCCACT:GTGGTCGATGAGGTCCGTACCGGAACCTACCGTCAGCTGT C + 88 5 +360 CACCCTGAGCAGCTGATCACTGGTAAGGAGGATGCGGCCAACAACTACGCCCGTGGCCACTACACCATCGGCAAGGAGATCGTCGATCTGGTTCTG-GACAGGATCC +990 GCAAGCTGGCCGATCAGTGCACQGGTCTGCAGGGCTTCCTCATCTTCCACTCGTTCGGTGGAGGTACCGGCTCCGGCTTCACCTCGCTGCTGATGGAGCGTCTCTC +1095 CGTGGACTACGGCAAGAAGTCCAAGCTGGAGTTCGCCATCTACCCAGCCCCCCAGGTGTCCACTGCCGTGGTCGAGCCCTACAACTCCATCCTGACCACCCACACC +120 0 ACCCTGGAGCATTCCGACTGCGCCTTCATGGTCGACAACGAGGCTATCTACGACATCTGCCGCCGCAACCTGGACATTGAGCGCCCCACGTACACCAACCTGAACC +1305 GTCTGATTGGCCAG TCGTGTCCTCGATTACCGCCTCTCTGCGATTCGATGGTGCCCTTAACGTGGATCTGACTGAGTTCCAGACCAACTTGGTGCCCTACCCACG +14 10 TATTCACTTCCCTCTGGTGACCTACGCCCCCGTTATCTCCGCCGAGAAGGCCTACCACGAGCAGCTGTrGGTGGrTGAGATCACCAACGCCTGCTTCGAGCCGGCC +1515 AACCAGATGGTCAAGTGCGATCCCCGTCACGGCAAGTACATGGCCTGCTGCATGCTGTA CCGCGGTGATGTTGTGCCCAAGGACGTCAACGCCGCTATTGCCACCA +1 62 0 TCAAGACCAAGCGCACCATTCAATTCGTCGACTGGTGCCCCACTGGCTTCAAGGTTGGCATCAACTACCAGCCACCCACCGTGGTGCCTGGAGGTGATTTGGCCAA + 172 5 GGTGCAGCGTGCCGTGTGCATGTTGTCCAACACCACGGCCATCGCCGAGGCCTGGGCCCGTCTGGACCACAAGTTcGATCTGATGTACGCCAAGCGTGCCTTCGTC +1830 CACTGGTACGTTGGTGAGGGTATGGAGGAGGGAGAGTTCTCCGAGGCCCGTGAGGATTTGGCTGCCCrTCGAGAAGGACTACGAGGAGGTCGGCATGGACTCCGGTG +193 5 ACGGCGAGGGTGAGGGCGCTGAGG GTACMsG.CGTCGCGCCACTTCAACGCTCGATQ.GGAGCGTCATTGGTGGGCGGGGTAACCGTCGAAATCAGTGTTTAC=c +2 04 0 TCCAATCGCAACAAAAAATTCACTGCAACACTGAAAAGCATACGAAAACGATGAAGATTGTACGAGAAACCATAAAGT