The effects of alterations in dietary magnesium on calcium, phosphate and skeletal metabolism

I. Clark,L. Bélanger

DOI: https://doi.org/10.1007/BF02008092

1967-12-20

Calcified Tissue Research

Abstract:

What problem does this paper attempt to address?

[Serum cytokine profiling of prostate cancer and benign prostatic hyperplasia using recombinant antibody microarray].

Lei Zhang,Sheng-kun Sun,Li-xin Shi,Xu Zhang

2010-07-01

Abstract:OBJECTIVE To identify the differential expressions of serum cytokines between prostate cancer (PCa) and benign prostatic hyperplasia (BPH), and provide proteomic evidence for the early diagnosis of PCa. METHODS We used human cytokine array to determine the profiles of the serum cytokines obtained from 6 PCa and 6 BPH patients with the PSA level within the grey scale of 4 - 10 ng/ml. RESULTS We identified 19 differentially expressed cytokines in the PCa patients, 16 obviously up-regulated, including IL-3, IL-6 and IL-16, and 3 markedly down-regulated, which were Fas/TNFRSF6, TRALR-3 and IGFBP-6. Most of them were involved in such cellular bioprocesses as transcription, proliferation, signal transduction, and apoptosis. CONCLUSION The cytokine antibody assay permits simultaneous measurement of multiple markers in a small volume of serum, and can identify a panel of key cytokines related to the malignant biological behavior of cancer cells. And it helps to find the biomarkers for the early diagnosis, efficacy assessment and prognosis of prostate cancer.
Nutrition-Related Mobile Apps in the China App Store: Assessment of Functionality and Quality

Yuan Li,Jingmin Ding,Yishan Wang,Chengyao Tang,Puhong Zhang

DOI: https://doi.org/10.2196/13261

2019-07-30

Abstract:Background: There are an increasing number of mobile apps that provide dietary guidance to support a healthy lifestyle and disease management. However, the characteristics of these nutrition-related apps are not well analyzed. Objective: This study aimed to evaluate the functionality and quality of nutrition-related apps in China. Methods: Mobile apps providing dietary guidance were screened in the Chinese iOS and Android app stores in November 2017, using stepwise searching criteria. The first screening consisted of extracting information from the app descriptions. Apps that (1) were free, (2) contain information on diet and nutrition, and (3) were last updated after January 1, 2016, were downloaded for further analysis. Nutritional functionalities were determined according to the Chinese Dietary Guidelines framework. Market-related functionalities were developed from previous studies and tailored to downloaded apps. The quality of apps was assessed with the user version of the Mobile App Rating Scale (uMARS). Results: Out of 628 dietary guidance apps screened, 44 were nutrition-related. Of these, guidance was provided on diet exclusively (11/44, 25%), fitness (17/44, 39%), disease management (11/44, 25%), or maternal health (5/44, 11%). Nutritional functionalities included nutritional information inquiry (40/44, 91%), nutrition education (35/44, 80%), food record (34/44, 77%), diet analysis (34/44, 77%), and personalized recipes (21/44, 48%). Dietary analysis and suggestions mainly focused on energy intake (33/44, 75%) and less on other factors such as dietary structure (10/44, 23%). Social communication functionalities were available in 42 apps (96%), user incentives were supported in 26 apps (59%), and intelligent recognition technology was available in 8 apps (18%). The median score for the quality of the 44 apps, as determined on a 5-point uMARS scale, was 3.6 (interquartile range 0.7). Conclusions: Most nutrition-related apps are developed for health management rather than for dietary guidance exclusively. Although basic principles of energy balance are used, their nutritional functionality was relatively limited and not individualized. More efforts should be made to develop nutrition-related apps with evidence-based nutritional knowledge, comprehensive and personalized dietary guidance, and innovative technology.
A Review of Critical Features and General Issues of Freely Available mHealth Apps For Dietary Assessment

Ghalib Ahmed Tahir,Chu Kiong Loo,Foong Ming Moy,Nadine Kong

DOI: https://doi.org/10.48550/arXiv.2008.09883

2021-07-11

Abstract:Obesity is known to lower the quality of life substantially. It is often associated with increased chances of non-communicable diseases such as diabetes, cardiovascular problems, various cancers, etc. Evidence suggests that diet-related mobile applications play a vital role in assisting individuals in making healthier choices and keeping track of food intake. However, due to an abundance of similar applications, it becomes pertinent to evaluate each of them in terms of functionality, usability, and possible design issues to truly determine state-of-the-art solutions for the future. Since these applications involve implementing multiple user requirements and recommendations from different dietitians, the evaluation becomes quite complex. Therefore, this study aims to review existing dietary applications at length to highlight key features and problems that enhance or undermine an application's usability. For this purpose, we have examined the published literature from various scientific databases of the PUBMED, CINAHL (January 2010-December 2019) and Science Direct (2010-2019). We followed PRISMA guidelines, and out of our findings, fifty-six primary studies met our inclusion criteria after identification, screening, eligibility and full-text evaluation. We analyzed 35 apps from the selected studies and extracted the data of each of the identified <a class="link-external link-http" href="http://apps.Following" rel="external noopener nofollow">this http URL</a> our detailed analysis on the comprehensiveness of freely available mHealth applications, we specified potential future research challenges and stated recommendations to help grow clinically accurate diet-related applications.

Computers and Society,Human-Computer Interaction,Multimedia
Mercury in dated Greenland marine sediments.

G. Asmund,S. Nielsen

DOI: https://doi.org/10.1016/S0048-9697(99)00433-7

2000-01-17

Abstract:
Assessment of nutrition-focused mobile apps' influence on consumers' healthy food behaviour and nutrition knowledge

Antonella Samoggia,Bettina Riedel

DOI: https://doi.org/10.1016/j.foodres.2019.108766

Abstract:The research explored if a nutrition-information app influences consumers' healthy food behavior and whether consumers improve their knowledge towards healthy food. Diet and nutrition apps are among the most popular health and fitness apps used by an increasing number of mobile device users. The analyzed app reads the product labels. Then it assesses the quality of ingredients and nutritional values based on user's personal data, such as age and physical activity level, and recommends healthier food alternatives. Scientific evidence of the effectiveness of nutrition-information apps for promoting consumers' healthy food behavior is still limited. The theoretical framework of the study is grounded in constructs from Health Belief Model (HBM) and Trans-theoretical Model (TTM) theories. Data were collected from consumers that spontaneously downloaded an existing nutrition-information app. Out of the 7000 consumers contacted, 143 respondents filled in both the baseline and follow-up questionnaires. The questionnaires included items deriving from the HBM and TTM theoretical constructs adopted, that is self-reported stage of change, susceptibility, severity, benefits, barriers, self-efficacy, cues to action, perceived and objective healthy food knowledge. The average age of respondents is 38 year-old and the sample of respondents is well distributed in terms of level of education, gender, income, working status, and geographical distribution. Findings of the study showed that nutrition-information apps can be effective in overcoming what consumers perceive as personal limitations in approaching healthy food. This is particularly evident among consumers that are building their motivation and concretely planning actions in favor of healthy eating. In particular, using a nutrition-information app decreases the perception of the barriers to healthy food eating. Users have a higher perceived personal strength and self-confidence in approaching healthy food. App users improved their objective and subjective knowledge of healthy food. The results confirmed the effectiveness of the theoretical framework. The results support that family members and friends play a specific role in healthy food behavior inclination. This suggests the inclusion of an additional theoretical construct, the social and family influence construct, when assessing the effectiveness of nutrition-information apps. To improve nutrition-information app effectiveness, the recommendation is that consumer behavior scientists, marketing researchers, nutritionists, and app developers cooperate in the apps design.
Does Hyperoxia Alter the Mechanoreflex in Young Healthy Males and Females?: 1659 Board #312 June 2, 9: 00 AM - 10: 30 AM.

L. Zornoza,A. Keller,S. Ives

DOI: https://doi.org/10.1249/01.mss.0000486384.97998.65

2016-05-01

Medicine & Science in Sports & Exercise

Abstract:
Smartphone applications for nutrition Support: A systematic review of the target outcomes and main functionalities

Daniele Pala,Giorgia Petrini,Pietro Bosoni,Cristiana Larizza,Silvana Quaglini,Giordano Lanzola

DOI: https://doi.org/10.1016/j.ijmedinf.2024.105351

IF: 4.73

2024-01-30

International Journal of Medical Informatics

Abstract:Introduction A proper nutrition is essential for human life. Recently, special attention on this topic has been given in relation to three health statuses: obesity, malnutrition and specific diseases that can be related to food or treated with specific diets. Mobile technology is often used to assist users that wish to regulate their eating habits, and identifying which fields of application have been explored the most by the app developers and which main functionalities have been adopted can be useful in view of future app developments. Methods We selected 322 articles mentioning nutrition support apps through a literature database search, all of which have undergone an initial screening. After the exclusion of papers that were already reviews, not presenting apps or not focused on nutrition, not relevant or not developed for human subjects, 100 papers were selected for subsequent analyses that aimed at identifying the main treated conditions, outcome measures and functionalities implemented in the Apps. Results Of the selected studies, 33 focus on specific diseases, 24 on obesity, 2 on malnutrition and 41 on other targets (e.g., weight/diet control). Type 2 diabetes is the most targeted disease, followed by gestational diabetes, hypertension, colorectal cancer and CVDs which all were targeted by more than one app. Most Apps include self-monitoring and coaching functionalities, educational content and artificial intelligence (AI) tools are slightly less common, whereas counseling, gamification and questionnaires are the least implemented. Body weight and calories/nutrients were the most common general outcome measures, while glycated hemoglobin (HbA1c) was the most common clinical outcome. No statistically significant differences in the effectiveness of the different functionalities were found. Conclusion The use of mobile technology to improve nutrition has been widely explored in the last years, especially for weight control and specific diseases like diabetes; however, other food-related conditions such as Irritable Bowel Diseases appear to be less targeted by newly developed smartphone apps and their related studies. All different kinds of functionalities appear to be equally effective, but further specific studies are needed to confirm the results.

health care sciences & services,computer science, information systems,medical informatics
Morphological changes and increased sucrase and isomaltase activity in small intestines of insulin-deficient and type 2 diabetic rats.

T. Adachi,C. Mori,K. Sakurai,N. Shihara,K. Tsuda,K. Yasuda

DOI: https://doi.org/10.1507/ENDOCRJ.50.271

2003-06-01

Endocrine Journal

Abstract:The small intestine plays an important role in the digestion and absorption of many nutrients. To investigate the contribution of carbohydrate digestion to diabetes mellitus, we examined the morphological changes of the small intestine, and the expression of sucrase-isomaltase, which is one of the intestinal disaccharidases, in diabetic model rat, that is the streptozotocin-induced (STZ) diabetic rat (insulin-deficient model), and the Otsuka Long-Evans Tokushima Fatty (OLETF) rats and the Goto-Kakizaki (GK) rats (type 2 diabetic models). Intestinal hyperplasia was observed in STZ, OLETF, and GK rats. Moreover, in the small intestine of each diabetic strain, the proliferating cell nuclear antigen (PCNA)-labeling index, which is a marker of proliferation, was higher than in the respective control. Cdx1 and Cdx2, known to be transcriptional factors related to intestinal proliferation and differentiation, were more highly expressed in STZ, OLETF and GK rats than in the respective controls. These findings indicate that small intestinal hyperplasia, and thereby the resultant increase of total activity of disaccharidases such as sucrase and isomaltase in the entire small intestine, might be one of the reasons for postprandial hyperglycemia in diabetes mellitus.
DiaFit: the Development of a Smart App for Patients with Type 2 Diabetes and Obesity

François Modave,Jiang Bian,Eric Rosenberg,Tonatiuh Mendoza,Zhan Liang,Ravi Bhosale,Carlos Maeztu,Camila Rodriguez,Michelle I Cardel

DOI: https://doi.org/10.2196/diabetes.6662

2016-01-01

JMIR Diabetes

Abstract:Background Optimal management of chronic diseases, such as type 2 diabetes (T2D) and obesity, requires patient-provider communication and proactive self-management from the patient. Mobile apps could be an effective strategy for improving patient-provider communication and provide resources for self-management to patients themselves. Objective The objective of this paper is to describe the development of a mobile tool for patients with T2D and obesity that utilizes an integrative approach to facilitate patient-centered app development, with patient and physician interfaces. Our implementation strategy focused on the building of a multidisciplinary team to create a user-friendly and evidence-based app, to be used by patients in a home setting or at the point-of-care. Methods We present the iterative design, development, and testing of DiaFit, an app designed to improve the self-management of T2D and obesity, using an adapted Agile approach to software implementation. The production team consisted of experts in mobile health, nutrition sciences, and obesity; software engineers; and clinicians. Additionally, the team included citizen scientists and clinicians who acted as the de facto software clients for DiaFit and therefore interacted with the production team throughout the entire app creation, from design to testing. Results DiaFit (version 1.0) is an open-source, inclusive iOS app that incorporates nutrition data, physical activity data, and medication and glucose values, as well as patient-reported outcomes. DiaFit supports the uploading of data from sensory devices via Bluetooth for physical activity (iOS step counts, FitBit, Apple watch) and glucose monitoring (iHealth glucose meter). The app provides summary statistics and graphics for step counts, dietary information, and glucose values that can be used by patients and their providers to make informed health decisions. The DiaFit iOS app was developed in Swift (version 2.2) with a Web back-end deployed on the Health Insurance Portability and Accountability Act compliant-ready Amazon Web Services cloud computing platform. DiaFit is publicly available on GitHub to the diabetes community at large, under the GNU General Public License agreement. Conclusions Given the proliferation of health-related apps available to health consumers, it is essential to ensure that apps are evidence-based and user-oriented, with specific health conditions in mind. To this end, we have used a software development approach focusing on community and clinical engagement to create DiaFit, an app that assists patients with T2D and obesity to better manage their health through active communication with their providers and proactive self-management of their diseases.
The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

H. Hori,S. Osawa,K. Murao,H. Ishikura

DOI: https://doi.org/10.1093/NAR/8.22.5423

IF: 14.9

1980-11-25

Nucleic Acids Research

Abstract:The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria.
Proteomics Differentiate Between Thyroid-Associated Orbitopathy and Dry Eye Syndrome.

N. Matheis,F. Grus,M. Breitenfeld,Ivo Knych,S. Funke,S. Pitz,K. Ponto,N. Pfeiffer,G. Kahaly

DOI: https://doi.org/10.1167/iovs.15-16699

2015-04-01

Investigative Ophthalmology and Visual Science

Abstract:PURPOSE In patients with thyroid-associated orbitopathy (TAO), the dry eye syndrome occurs frequently, and symptoms and signs of both disorders overlap making early and accurate differential diagnosis difficult. A differentiation via specific markers is warranted. METHODS Tear fluid samples of 120 subjects with TAO, TAO + dry eye, dry eye, and controls were collected. The samples were measured using matrix-assisted laser desorption ionization mass spectrometry. The identified proteins were tested with antibody microarrays. RESULTS Proteomics identified deregulated proteins in TAO and dry eye. Compared with dry eye, proline-rich protein 1 (PROL1, P = 0.002); uridine diphosphate (UDP)-glucose-dehydrogenase (UGDH, P = 0.017); calgranulin A (S10A8, P < 0.0001); transcription-activator BRG1 (SMCA4, P < 0.0001); annexin A1 (P = 0.007); cystatin (P = 0.009); heat shock protein 27 (P = 0.03); and galectin (P = 0.04) were markedly downregulated in TAO. Compared with healthy controls, PROL1 (P < 0.05.); proline-rich protein 4 (PRP4, P < 0.05), S10A8 (P = 0.004) and SMCA4 (P = 0.002) were downregulated in TAO. In contrast, the proteins midasin and POTE-ankyrin-domain family-member I were upregulated in TAO versus healthy controls (P < 0.05). Protein dysregulation was associated with inflammatory response and cell death. Antibody microarray confirmed significant changes of PRP4, PROL1, and UGDH between TAO and dry eye or healthy controls (P < 0.01). The presence of these three proteins was negatively correlated with smoking (P < 0.05). CONCLUSIONS Proteomics of tear fluid demonstrated an upregulation of inflammatory proteins versus a downregulation of protective proteins in TAO, and a significantly different protein panel in TAO versus dry eye and/or controls. The spectrum of inflammatory and protective proteins might be a useful indicator for disease activity and ocular surface disease in patients with TAO.
Validating Accuracy of a Mobile Application against Food Frequency Questionnaire on Key Nutrients with Modern Diets for mHealth Era

Joyce D. Kusuma,Hsiao-Ling Yang,Ya-Ling Yang,Zhao-Feng Chen,Shyang-Yun Pamela Koong Shiao

DOI: https://doi.org/10.3390/nu14030537

IF: 5.9

2022-01-26

Nutrients

Abstract:In preparation for personalized nutrition, an accurate assessment of dietary intakes on key essential nutrients using smartphones can help promote health and reduce health risks across vulnerable populations. We, therefore, validated the accuracy of a mobile application (app) against Food Frequency Questionnaire (FFQ) using artificial intelligence (AI) machine-learning-based analytics, assessing key macro- and micro-nutrients across various modern diets. We first used Bland and Altman analysis to identify and visualize the differences between the two measures. We then applied AI-based analytics to enhance prediction accuracy, including generalized regression to identify factors that contributed to the differences between the two measures. The mobile app underestimated most macro- and micro-nutrients compared to FFQ (ranges: −5% for total calories, −19% for cobalamin, −33% for vitamin E). The average correlations between the two measures were 0.87 for macro-nutrients and 0.84 for micro-nutrients. Factors that contributed to the differences between the two measures using total calories as an example, included caloric range (1000–2000 versus others), carbohydrate, and protein; for cobalamin, included caloric range, protein, and Chinese diet. Future studies are needed to validate actual intakes and reporting of various diets, and to examine the accuracy of mobile App. Thus, a mobile app can be used to support personalized nutrition in the mHealth era, considering adjustments with sources that could contribute to the inaccurate estimates of nutrients.

nutrition & dietetics
Incorporating Consumers' Needs in Nutrition Apps to Promote and Maintain Use: Mixed Methods Study

Sandra van der Haar,Ireen Raaijmakers,Muriel C D Verain,Saskia Meijboom

DOI: https://doi.org/10.2196/39515

2023-06-20

Abstract:Background: Nutrition apps seem to be promising tools for supporting consumers toward healthier eating habits. There is a wide variety of nutrition apps available; however, users often discontinue app use at an early stage before a permanent change in dietary behavior can be achieved. Objective: The main objective of this study was to identify, from both a user and nonuser perspective, which functionalities should be included in nutrition apps to increase intentions to start and maintain use of these apps. A secondary objective was to gain insight into reasons to quit using nutrition apps at an early stage. Methods: This study used a mixed methods approach and included a qualitative and a quantitative study. The qualitative study (n=40) consisted of a home-use test with 6 commercially available nutrition apps, followed by 6 focus group discussions (FGDs) to investigate user experiences. The quantitative study was a large-scale survey (n=1420), which was performed in a representative sample of the Dutch population to quantify the FGDs' results. In the survey, several app functionalities were rated on 7-point Likert scales ranging from 1 (very unimportant) to 7 (very important). Results: A total of 3 different phases of app use, subdivided into 10 user-centric app aspects and 46 associated app functionalities, were identified as relevant nutrition app elements in the FGDs. Relevance was confirmed in the survey, as all user-centric aspects and almost all app functionalities were rated as important to include in a nutrition app. In the starting phase, a clear introduction (mean 5.45, SD 1.32), purpose (mean 5.40, SD 1.40), and flexible food tracking options (mean 5.33, SD 1.45) were the most important functionalities. In the use phase, a complete and reliable food product database (mean 5.58, SD 1.41), easy navigation (mean 5.56, SD 1.36), and limited advertisements (mean 5.53, SD 1.51) were the most important functionalities. In the end phase, the possibility of setting realistic goals (mean 5.23, SD 1.44), new personal goals (mean 5.13, SD 1.45), and continuously offering new information (mean 4.88, SD 1.44) were the most important functionalities. No large differences between users, former users, and nonusers were found. The main reason for quitting a nutrition app in the survey was the high time investment (14/38, 37%). This was also identified as a barrier in the FGDs. Conclusions: Nutrition apps should be supportive in all 3 phases of use (start, use, and end) to increase consumers' intentions to start and maintain the use of these apps and achieve a change in dietary behavior. Each phase includes several key app functionalities that require specific attention from app developers. High time investment is an important reason to quit nutrition app use at an early stage.
Recognition of Culturally Diverse Cuisine in Popular Nutrition Apps

Alexis Cathcart,Matthew Wiggins,William Kelly,Christopher Doss,Yvonne Ford,Robert Hubal,Kristen Rhinehardt

DOI: https://doi.org/10.1093/cdn/nzac066.002

2022-06-01

Current Developments in Nutrition

Abstract:Abstract <sec> Objectives Nutrition apps have been designed to assist users in determining the nutritional value of their food in alliance with their dietary restrictions and/or health. However, many of these apps do not incorporate or recognize the cuisine of the diverse communities that they serve. In this work we assessed several of the most popular free apps and compared with the most popular dishes in Latin America, Europe, India, East Asia, West Africa, and the American South to determine the rate of recognition of culturally diverse cuisines in popular nutrition apps. </sec> <sec> Methods We built a consensus database of over 150 culturally popular foods via a web scraper for foods from Latin American, Europe, India, East Asia, West Africa, and the American South. Researched & logged popular dishes from International cuisines with their corresponding nutritional data. Each food item was run against Calorie Mama, Lose It, My Fitness Pal and My Plate to determine the recognition and availability of the nutritional value. </sec> <sec> Results European and Indian dishes were better recognized (greater than 70%) across all apps than West African and Latin American dishes. Of the dishes that were recognizable, most were due to manual entry and lacked some of the nutritional information, making the apps less useful. </sec> <sec> Conclusions We note a bias among popular nutrition apps in not taking into account cuisines, from both international and regional American communities, leaving many communities underserved and contributing to health inequalities gap. </sec> <sec> Funding Sources N/A. </sec>
Evaluating the Energy Efficiency of Popular US Smartphone Health Care Apps: Comparative Analysis Study Toward Sustainable Health and Nutrition Apps Practices

Abdullah Almasri,Tatyana Y El-Kour,Liliana Silva,Yousef Abdulfattah

DOI: https://doi.org/10.2196/58311

2024-05-10

Abstract:Background: The emergence of smartphones has sparked a transformation across multiple fields, with health care being one of the most notable due to the advent of mobile health (mHealth) apps. As mHealth apps have gained popularity, there is a need to understand their energy consumption patterns as an integral part of the evolving landscape of health care technologies. Objective: This study aims to identify the key contributors to elevated energy consumption in mHealth apps and suggest methods for their optimization, addressing a significant void in our comprehension of the energy dynamics at play within mHealth apps. Methods: Through quantitative comparative analysis of 10 prominent mHealth apps available on Android platforms within the United States, this study examined factors contributing to high energy consumption. The analysis included descriptive statistics, comparative analysis using ANOVA, and regression analysis to examine how certain factors impact energy use and consumption. Results: Observed energy use variances in mHealth apps stemmed from user interactions, features, and underlying technology. Descriptive analysis revealed variability in app energy consumption (150-310 milliwatt-hours), highlighting the influence of user interaction and app complexity. ANOVA verified these findings, indicating the critical role of engagement and functionality. Regression modeling (energy consumption = β₀ + β₁ × notification frequency + β₂ × GPS use + β₃ × app complexity + ε), with statistically significant P values (notification frequency with a P value of .01, GPS use with a P value of .05, and app complexity with a P value of .03), further quantified these bases' effects on energy use. Conclusions: The observed differences in the energy consumption of dietary apps reaffirm the need for a multidisciplinary approach to bring together app developers, end users, and health care experts to foster improved energy conservation practice while achieving a balance between sustainable practice and user experience. More research is needed to better understand how to scale-up consumer engagement to achieve sustainable development goal 12 on responsible consumption and production.
Comprehensive overview of smartphone applications delivering child nutrition information

Rachana Srivastava,Savitesh Kushwaha,Poonam Khanna,Madhu Gupta,Bhavneet Bharti,Rachita Jain

DOI: https://doi.org/10.1016/j.nut.2022.111773

IF: 4.893

Nutrition

Abstract:Numerous smartphone-based applications that guide parenting, child nutrition, and child health-related knowledge are available. Here, we reviewed the applications available in the Google Play Store for child nutrition, primarily focused on children aged <5 y. The keywords used in the search were "child nutrition," "child nutrition status assessment," and "parenting." We identified 370 apps from the play store and 33 qualified for the review. Among 33 apps, 3 were not updated in the last 3 mo, and 19 did not mention their source of information. Four apps did not require the child's name, date of birth, and sex for logging in. Twenty-three apps were available in English only. The output features of the selected apps were food, growth, development and vaccine trackers, data export, reminders, meal planner, feeding tips, list of food, recipes details, information about nutrients, and question/answer session with the expert. Only eight apps provided access to consultation with experts and three suggested nutrient requirements of the child. Three apps scored similarly based on features, although the feature types differed. Findings from this review suggest that the apps do not follow any uniform guidelines for delivering the child nutrition information to the caregivers. About 50% of apps did not mention the consulted source for its development, indicating the unavailability of uniform guidelines or policy documents for child nutrition app development. App-based intervention studies are recommended to assess the effectiveness of child nutrition/health smartphone applications.
Valuable Features in Mobile Health Apps for Patients and Consumers: Content Analysis of Apps and User Ratings

Martin F Mendiola,Miriam Kalnicki,Sarah Lindenauer

DOI: https://doi.org/10.2196/mhealth.4283

2015-05-13

JMIR mhealth and uhealth

Abstract:BACKGROUND: The explosion of mobile phones with app capabilities coupled with increased expectations of the patient-consumers' role in managing their care presents a unique opportunity to use mobile health (mHealth) apps.OBJECTIVES: The aim of this paper is to identify the features and characteristics most-valued by patient-consumers ("users") that contribute positively to the rating of an app.METHODS: A collection of 234 apps associated with reputable health organizations found in the medical, health, and fitness categories of the Apple iTunes store and Google Play marketplace was assessed manually for the presence of 12 app features and characteristics. Regression analysis was used to determine which, if any, contributed positively to a user's rating of the app.RESULTS: Analysis of these 12 features explained 9.3% (R(2)=.093 n=234, P<.001) of the variation in an app's rating, with only 5 reaching statistical significance. Of the 5 reaching statistical significance, plan or orders, export of data, usability, and cost contributed positively to a user's rating, while the tracker feature detracted from it.CONCLUSIONS: These findings suggest that users appreciate features that save time over current methods and identify an app as valuable when it is simple and intuitive to use, provides specific instructions to better manage a condition, and shares data with designated individuals. Although tracking is a core function of most health apps, this feature may detract from a user's experience when not executed properly. Further investigation into mHealth app features is worthwhile given the inability of the most common features to explain a large portion of an app's rating. In the future, studies should focus on one category in the app store, specific diseases, or desired behavior change, and methods should include measuring the quality of each feature, both through manual assessment and evaluation of user reviews. Additional investigations into understanding the impact of synergistic features, incentives, social media, and gamification are also warranted to identify possible future trends.

health care sciences & services,medical informatics
Food Recognition and Nutritional Apps

Lubnaa Abdur Rahman,Ioannis Papathanail,Lorenzo Brigato,Elias K. Spanakis,Stavroula Mougiakakou

DOI: https://doi.org/10.48550/arXiv.2307.05372

2023-06-20

Abstract:Food recognition and nutritional apps are trending technologies that may revolutionise the way people with diabetes manage their diet. Such apps can monitor food intake as a digital diary and even employ artificial intelligence to assess the diet automatically. Although these apps offer a promising solution for managing diabetes, they are rarely used by patients. This chapter aims to provide an in-depth assessment of the current status of apps for food recognition and nutrition, to identify factors that may inhibit or facilitate their use, while it is accompanied by an outline of relevant research and development.

Computer Vision and Pattern Recognition,Computers and Society
Usage of Mobile Applications or Mobile Health Technology to Improve Diet Quality in Adults

Alan Scarry,Jennifer Rice,Eibhlís M. O'Connor,Audrey C. Tierney

DOI: https://doi.org/10.3390/nu14122437

IF: 5.9

2022-06-12

Nutrients

Abstract:The use of mobile applications for dietary purposes has dramatically increased along with the consistent development of mobile technology. Assessing diet quality as a dietary pattern or an indicator across key food groups in comparison to those recommended by dietary guidelines is useful for identifying optimal nutrient intake. This systematic review aims to explore mobile applications and their impact on the diet quality of the user. The electronic databases of The Cumulative Index to Nursing and Allied Health Literature (Cinahl), The American Psychological Association's (APA Psycinfo), and PubMed were systematically searched for randomised and non-randomised controlled trials to retrieve papers from inception to November 2021. Ten studies with 1638 participants were included. A total of 5342 studies were retrieved from the database searches, with 10 articles eligible for final inclusion in the review. The sample sizes ranged from 27 to 732 participants across the included studies, with 1638 total participants. The ratio of female to male participants in the studies was 4:1. The majority of the mobile applications or M-health interventions were used to highlight dietary health changes (six studies), with the remainder used to reduce weight or blood sugar levels (four studies). Each study used a different measure to quantify diet quality. Studies were either assessed by diet quality scoring or individual dietary assessment, of the ten studies, six studies reported an improvement in diet quality following diet-related mobile application use. Mobile applications may be an effective way to improve diet quality in adults; however, there is a need for more targeted and longer-term studies that are expressly designed to investigate the impact using mobile applications has on diet quality.

nutrition & dietetics
Mitigating errors in mobile-based dietary assessments: Effects of a data modification process on the validity of an image-assisted food and nutrition app

Dang Khanh Ngan Ho,Wan-Chun Chiu,Jing-Wen Kao,Hsiang-Tung Tseng,Chih-Yuan Yao,Hsiu-Yueh Su,Pin-Hui Wei,Nguyen Quoc Khanh Le,Hung Trong Nguyen,Jung-Su Chang

DOI: https://doi.org/10.1016/j.nut.2023.112212

IF: 4.893

2023-09-30

Nutrition

Abstract:Objective Mobile nutrition applications (apps) provide a simple way for individuals to record their diet, but the validity and inherent errors need to be carefully evaluated. The aim of this study was to assess the validity and clarify the sources of measurement errors of image-assisted mobile nutrition apps. Methods This was a cross-sectional study with 98 students recruited from School of Nutrition and Health Sciences, Taipei Medical University. A 3-d nutrient intake record by Formosa Food and Nutrient Recording App (FoodApp) was compared with a 24-h dietary recall (24-HDR). A two-stage data modification process, manual data cleaning, and reanalyzing of prepackaged foods were employed to address inherent errors. Nutrient intake levels obtained by the two methods were compared with the recommended daily intake (DRI), Taiwan. Paired t test, Spearman's correlation coefficients, and Bland–Altman plots were used to assess agreement between the FoodApp and 24-HDR. Results Manual data cleaning identified 166 food coding errors (12%; stage 1), and 426 food codes with missing micronutrients (32%) were reanalyzed (stage 2). Positive linear trends were observed for total energy and micronutrient intake (all P trend < 0.05) after the two stages of data modification, but not for dietary fat, carbohydrates, or vitamin D. There were no statistical differences in mean energy and macronutrient intake between the FoodApp and 24-HDR, and this agreement was confirmed by Bland–Altman plots. Spearman's correlation analyses showed strong to moderate correlations ( r = 0.834 ∼ 0.386) between the two methods. Participants' nutrient intake tended to be lower than the DRI, but no differences in proportions of adequacy/inadequacy for DRI values were observed between the two methods. Conclusions Mitigating errors significantly improved the accuracy of the Formosa FoodApp, indicating its validity and reliability as a self-reporting mobile-based dietary assessment tool. Dietitians and health professionals should be mindful of potential errors associated with self-reporting nutrition apps, and manual data cleaning is vital to obtain reliable nutrient intake data.

nutrition & dietetics

The effects of alterations in dietary magnesium on calcium, phosphate and skeletal metabolism

[Serum cytokine profiling of prostate cancer and benign prostatic hyperplasia using recombinant antibody microarray].

Nutrition-Related Mobile Apps in the China App Store: Assessment of Functionality and Quality

A Review of Critical Features and General Issues of Freely Available mHealth Apps For Dietary Assessment

Mercury in dated Greenland marine sediments.

Assessment of nutrition-focused mobile apps' influence on consumers' healthy food behaviour and nutrition knowledge

Does Hyperoxia Alter the Mechanoreflex in Young Healthy Males and Females?: 1659 Board #312 June 2, 9: 00 AM - 10: 30 AM.

Smartphone applications for nutrition Support: A systematic review of the target outcomes and main functionalities

Morphological changes and increased sucrase and isomaltase activity in small intestines of insulin-deficient and type 2 diabetic rats.

DiaFit: the Development of a Smart App for Patients with Type 2 Diabetes and Obesity

The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

Proteomics Differentiate Between Thyroid-Associated Orbitopathy and Dry Eye Syndrome.

Validating Accuracy of a Mobile Application against Food Frequency Questionnaire on Key Nutrients with Modern Diets for mHealth Era

Incorporating Consumers' Needs in Nutrition Apps to Promote and Maintain Use: Mixed Methods Study

Recognition of Culturally Diverse Cuisine in Popular Nutrition Apps

Evaluating the Energy Efficiency of Popular US Smartphone Health Care Apps: Comparative Analysis Study Toward Sustainable Health and Nutrition Apps Practices

Comprehensive overview of smartphone applications delivering child nutrition information

Valuable Features in Mobile Health Apps for Patients and Consumers: Content Analysis of Apps and User Ratings

Food Recognition and Nutritional Apps

Usage of Mobile Applications or Mobile Health Technology to Improve Diet Quality in Adults

Mitigating errors in mobile-based dietary assessments: Effects of a data modification process on the validity of an image-assisted food and nutrition app