Heterosexual transmission of human immunodeficiency virus type 1 subtype C in southern Brazil.

J. Silveira,André F. A. Santos,A. M. Martínez,L. R. Goes,R. Mendoza-Sassi,C. P. Muniz,U. Tupinambás,M. Soares,D. Greco

DOI: https://doi.org/10.1016/j.jcv.2012.01.017

IF: 14.481

2012-05-01

Journal of Clinical Virology

Abstract:

What problem does this paper attempt to address?

The effect of continuous enteral nutrition on gastric acidity in humans.

D. Armstrong,F. Castiglione,C. Emde,T. Cilluffo,P. Duroux,J. Koerfer,E. Temler,C. Lamers,J. Jansens,A. Blum

DOI: https://doi.org/10.1016/0016-5085(92)91708-C

IF: 29.4

1992-05-01

Gastroenterology

Abstract:
Diversity of hirudin and hirudin-like factor genes in the North-African medicinal leech, Hirudo troctina

Raja Ben Ahmed,Amina Abilov,Christian Müller

DOI: https://doi.org/10.1007/s00436-024-08411-x

2024-11-19

Parasitology Research

Abstract:Medicinal leeches of the genus Hirudo inhabit large areas of the Palaearctic realm. The distribution range of Hirudo troctina includes the southern Iberian peninsula and the northwestern regions of Africa. H. troctina is used for medical purposes, but only very little is known about the components of its salivary gland secretion. Hirudins, bivalent inhibitors of thrombin, are probably the best known leech-derived bioactive factors. Hirudin-like factors (HLFs) represent another class of salivary gland components that share characteristic genetic and structural markers with hirudins. Hirudin is not a single entity but exists in at least four different variants. However, there are differences among the European members of the genus Hirudo with respect to the actual number of hirudin and HLF genes that are present within their genomes. Here, we describe the identification and molecular cloning of 11 genes that encode for putative hirudin and HLF variants in H. troctina . Three of the genes consist of exons and introns that originate from different "archetype" genes and are likely the result of recombination events. The diversity of hirudin and HLF genes in H. troctina surpasses that of all other European members of the genus Hirudo . The putative hirudin variants and representatives of the HLFs of H. troctina were expressed as recombinant proteins, purified and functionally characterized for their thrombin-inhibiting potencies. Phylogenetic analyses based on hirudin and HLF gene sequences of the leech genera Hirudo , Hirudinaria , and Whitmania supported the hypothesis that hirudins and HLFs diverged early in leech evolution.

parasitology
Hirudin and Decorsins of the North American Medicinal Leech Macrobdella decora: Gene Structure Reveals Homology to Hirudins and Hirudin-like Factors of Eurasian Medicinal Leeches

Christian Müller,Phil Lukas,Sarah Lemke,Jan-Peter Hildebrandt

Abstract:Blood-sucking leeches, some of which are referred to as medicinal leeches, have caught attention not only because of their medical purposes, but also as study organisms to conduct research within fields as diverse as neurobiology, osmoregulation, ecology, and phylogeny. Of particular interest is the question whether hemophagy in leeches is of single origin or evolved independently several times. A key component in the saliva of hematophagous leeches is hirudin, a strong natural inhibitor of thrombin and hence the blood coagulation cascade. Multiple isoforms of hirudin have been described within and among several leech species and genera, often based on sequence data only. The identification of hirudin-like factors (HLFs) illustrated the necessity to underpin such predictions by functional tests. We overexpressed and purified the hirudin of the North American medicinal leech, Macrobdella decora, and proved its thrombin-inhibiting activity. In addition, analysis of the gene structure of both hirudin and some of the decorsins of M. decora clearly indicated conserved exon and intron positions when compared to genes of hirudins and HLFs of Eurasian medicinal leeches. Our data provide evidence for the incorporation of decorsins into the hirudin superfamily and support the concept of a single origin of blood feeding in jawed leeches.
The hirudin-like factors HLF3 and HLF4-hidden hirudins of European medicinal leeches

Christian Müller,Phil Lukas,Dana Sponholz,Jan-Peter Hildebrandt

DOI: https://doi.org/10.1007/s00436-020-06697-1

Abstract:The hirudin-like factors 3 (HLF3) and 4 (HLF4) belong to a new class of leech-derived factors and are present in specimens of the three European medicinal leeches, Hirudo medicinalis, Hirudo verbana, and Hirudo orientalis, respectively. Here we describe the functional analysis of natural and synthetic variants of HLF3 and HLF4. Whereas the natural variants display only very low or no detectable anti-coagulatory activities, modifications within the N-termini in combination with an exchange of the central globular domain have the potency to greatly enhance the inhibitory effects of respective HLF3 and HLF4 variants on blood coagulation. Our results support previous observations on the crucial importance of all parts (both the N- and C-termini as well as the central globular domains) of hirudin and HLF molecules for thrombin inhibition.
NutraStick: portable diet assistant

Barry Mulrooney,M. McDermott,Nick Earley

DOI: https://doi.org/10.1145/1125451.1125802

2006-04-21

Abstract:This paper describes the design of a programmable barcode scanner (the NutraStick) that aims to revolutionize the way people on any kind of diet shop. The NutraStick uses barcode scanning technology alongside an onboard ingredient/nutritional information database to give feedback (Red or Green light) as to whether a particular food item is suitable or not for a person on a specific diet. Usability engineering protocols were used in the design process including feasibility testing and a user orientated interface design process. The use of this methodology allowed for a user friendly, simple, effective, and innovate design.
Short tail stories: the hirudin-like factors HLF6 and HLF7 of the Asian medicinal leech, Hirudinaria manillensis

Christian Müller,Chantal Eickelmann,Dana Sponholz,Jan-Peter Hildebrandt

DOI: https://doi.org/10.1007/s00436-021-07316-3

Abstract:The leech-derived hirudins and hirudin-like factors (HLFs) share a common molecule structure: a short N-terminus, a central globular domain, and an elongated C-terminal tail. All parts are important for function. HLF6 and HLF7 were identified in the Asian medicinal leech, Hirudinaria manillensis. The genes of both factors encode putative splice variants that differ in length and composition of their respective C-terminal tails. In either case, the tails are considerably shorter compared to hirudins. Here we describe the functional analyses of the natural splice variants and of synthetic variants that comprise an altered N-terminus and/or a modified central globular domain. All natural splice variants of HLF6 and HLF7 display no detectable thrombin-inhibitory potency. In contrast, some synthetic variants effectively inhibit thrombin, even with tails as short as six amino acid residues in length. Our data indicate that size and composition of the C-terminal tail of hirudins and HLFs can vary in a great extent, yet the full protein may still retain the ability to inhibit thrombin.
Characterization of a persistent respiratory syncytial virus showing a low-fusogenic activity associated to an impaired F protein.

R. E. Sarmiento,C. Arias,E. Méndez,B. Gómez

DOI: https://doi.org/10.1016/j.virusres.2008.10.007

IF: 6.286

Virus Research

Abstract:
Life without blood: Molecular and functional analysis of hirudins and hirudin-like factors of the Asian non-hematophagous leech Whitmania pigra

Christian Müller,Zhongjie Wang,Magdalena Hamann,Dana Sponholz,Jan-Peter Hildebrandt

DOI: https://doi.org/10.1111/jth.15762

Abstract:Background: Several leech species of the genera Hirudo, Hirudinaria, and Whitmania are widely used in traditional Chinese medicine (TCM) for the oral treatment of disorders associated with blood stasis. Among them, the non-hematophagous leech Whitmania pigra expresses a variety of components that have the potential to act on the vertebrate blood coagulation system. Objective: Whether the thrombin inhibitor hirudin, probably the most prominent leech-derived anticoagulant, is actually present in Whitmania pigra, is still a matter of debate. To answer that open question was the aim of the study. Methods: We identified several putative hirudin-encoding sequences in transcriptome data of Whitmania pigra. Upon gene synthesis and molecular cloning the respective recombinant proteins were expressed in Escherichia coli, purified, processed, and eventually functionally characterized for thrombin-inhibitory potencies in coagulation assays. Results: We were successful in the identification and functional characterization of several putative hirudins in Whitmania pigra. Some, but not all, of these factors are indeed thrombin inhibitors. Whitmania pigra hence expresses both hirudins (factors that inhibit thrombin) and hirudin-like factors (that do not or only very weakly inhibit thrombin). Furthermore, we revealed the exon/intron structures of the corresponding genes. Coding sequences of some putative hirudins of Whitmania pigra were present also in transcriptome datasets of Hirudo nipponia, a hematophagous leech that is likewise used in TCM. Conclusions: Based on both structural and functional data we provide very strong evidence for the expression of hirudins in Whitmania pigra. This is the first description of hirudins in a non-hematophagous leech.
Make it double: identification and characterization of a Tandem-Hirudin from the Asian medicinal leech Hirudinaria manillensis

Phil Lukas,Georgij Melikian,Jan-Peter Hildebrandt,Christian Müller

DOI: https://doi.org/10.1007/s00436-022-07634-0

Abstract:Haematophagous leeches express a broad variety of secretory proteins in their salivary glands, among them are hirudins and hirudin-like factors. Here, we describe the identification, molecular and initial functional characterization of Tandem-Hirudin (TH), a novel salivary gland derived factor identified in the Asian medicinal leech, Hirudinaria manillensis. In contrast to the typical structure of hirudins, TH comprises two globular domains arranged in a tandem-like orientation and lacks the elongated C-terminal tail. Similar structures of thrombin inhibitors have so far been identified only in kissing bugs and ticks. Expression of TH was performed in both cell-based and cell-free bacterial systems. A subsequent functional characterization revealed no evidence for a thrombin-inhibitory potency of TH.
[Pulmonary hypertension from the viewpoint of the pediatric pulmonologist].

M. Rutishauser,A. Amacher

1986-11-07

Wiener klinische Wochenschrift

Abstract:The main cause of secondary pulmonary hypertension in the view of a pulmonologist is alveolar hypoventilation - eventually potentiated by acidosis and hypercapnia - which leads to reflectory hypoxemic vasoconstriction of the small pulmonary arteries. Anatomic changes in the pulmonary vessels may be absent or may be limited to medial hypertrophy of the arterioles. If the underlying cause of the hypoxia can be corrected, this reflectory pulmonary hypertension is reversible. In diffuse progressive lung disease, interstitial fibrosis with destruction of the alveolar wall and capillaries may occur, leading to restriction of the pulmonary vascular bed. In such cases pulmonary hypertension may not be completely reversible. The most frequent causes of pulmonary hypertension in childhood are obstructive (e.g. Cystic Fibrosis) or restrictive lung diseases (e.g. interstitial fibrosis). Rare but important in the differential diagnosis are upper airway obstruction, thoracic cage deformity, neuromuscular disorders, high altitude and respiratory center dysfunction. The therapy is elimination of the underlying disease or optimal treatment. In addition prophylactic or therapeutic longterm application of oxygen is more efficient than treatment with pulmonary vasodilators or modern substances like Almitrine. Right heart decompensation should be treated by diuretics. The longterm prognosis is dependent of the underlying disease and is poor in a chronic progressive lung disease like cystic fibrosis and certain types of lung fibrosis.
Salivary gland transcriptome analysis in Hirudinaria sp. during different feeding periods and functional studies of HspHirudin

Boxing Cheng,Xiaoyun Hu,Suyan Wang,Xin Xie,Guiyan Shao,Qingqing Tian,Tianyi Gao,Fei Liu

DOI: https://doi.org/10.1007/s11756-024-01601-z

2024-02-29

Biologia

Abstract:Hirudinaria sp., as one of the origins of leeches used in traditional Chinese medicine, was proved clinically effective in treating cardiovascular and cerebrovascular diseases. Substances with pharmacological activities are stored in salivary glands of leeches. Among these substances, hirudin exhibits high anti-thrombin activity. However, the structure, function and expression pattern of HspHirudin in Hirudinaria sp. distributed in Guangxi were still unclear. Illumina HiSeq platform was used to obtain the transcriptome datasets of salivary glands from Hirudinaria sp. during different feeding periods. The function of HspHirudin was studied based on cDNA cloning, bioinformatics analysis, prokaryotic expression analysis and anti-thrombin activity analysis, and its expression pattern was characterized by quantitative real-time PCR. The reads were assembled into 167,564 unigenes and 9 unigenes with functions related to the process of blood meal ingestion were identified. After alignment, transcript (TRINITY_DN14935_c0_g2) was annotated to Hirudin-P6 (2E-31) from Poecilobdella manillensis and named HspHirudin. The HspHirudin cDNA was 249 bp in length, and it encoded a mature peptide of 82 aa and a signal peptide of 20 aa. The mature HspHirudin presented typical structural characteristics of hirudins: 3 pairs of disulfide bonds and the PKP and DFxxIP motifs. The structural differences of HspHirudin and Hirudin-P6 were observed in the spherical domain structure. By constructing a prokaryotic expression system, HspHirudin was proven to have anti-thrombin activity. The high expression of HspHirudin mRNA was induced by blood meal feeding. The results of the study provide theoretical basis for further development and utilization of Hirudinaria sp..

biology
Exploring a Hirudin variant from nonhematophagous leeches: Unraveling full-length sequence, alternative splicing, function, and potential as a novel anticoagulant polypeptide

Xiaozhe Yi,Jiali Liu,Erhuan Zang,Yu Tian,Jinxin Liu,Linchun Shi

DOI: https://doi.org/10.1016/j.jep.2024.118257

2024-08-10

Abstract:Ethnopharmacological relevance: Leeches exhibit robust anticoagulant activity, making them useful for treating cardiovascular diseases in traditional Chinese medicine. Whitmania pigra, the primary source species of leech-derived medicinal compounds in China, has been demonstrated to possess formidable anticoagulant properties. Hirudin-like peptides, recognized as potent thrombin inhibitors, are prevalent in hematophagous leeches. Considering that W. pigra is a nonhematophagic leech, the following question arises: does a hirudin variant exist in this species? Aim of the study: In this study we identified the hirudin-encoding gene (WP_HV1) in the W. pigra genome. The goal of this study was to assess its anticoagulant activity and analyze the related mechanisms. Materials and methods: In this study, a hirudin-encoding gene, WP_HV1, was identified from the W. pigra genome, and its accurate coding sequence (CDS) was validated through cloning from cDNA extracted from fresh W. pigra specimens. The structure of WP_HV1 and the amino acids associated with its anticoagulant activity were determined by sequence and structural analysis and prediction of its binding energy to thrombin. E. coli was used for the expression of WP_HV1 and recombinant proteins with various structures and mutants. The anticoagulant activity of the synthesized recombinant proteins was then confirmed using thrombin time (TT). Results: Validation of the WP_HV1 gene was accomplished, and three alternative splices were discovered. The TT of the blank sample exceeded that of the recombinant WP_HV1 sample by 1.74 times (0.05 mg/ml), indicating positive anticoagulant activity. The anticoagulant activity of WP_HV1 was found to be associated with its C-terminal tyrosine, along with the presence of 9 acidic amino acids on both the left and right sides. A significant reduction in the corresponding TT was observed for the mutated amino acids compared to those of the wild type, with decreases of 4.8, 6.6, and 3.9 s, respectively. In addition, the anticoagulant activity of WP_HV1 was enhanced and prolonged for 2.7 s when the lysine-67 residue was mutated to tryptophan. Conclusion: Only one hirudin-encoding variant was identified in W. pigra. The active amino acids associated with anticoagulation in WP_HV1 were resolved and validated, revealing a novel source for screening and developing new anticoagulant drugs.
Cell-free synthesis of the hirudin variant 1 of the blood-sucking leech Hirudo medicinalis

Doreen A. Wüstenhagen,Phil Lukas,Christian Müller,Simone A. Aubele,Jan-Peter Hildebrandt,Stefan Kubick

DOI: https://doi.org/10.1038/s41598-020-76715-w

IF: 4.6

2020-11-13

Scientific Reports

Abstract:Abstract Synthesis and purification of peptide drugs for medical applications is a challenging task. The leech-derived factor hirudin is in clinical use as an alternative to heparin in anticoagulatory therapies. So far, recombinant hirudin is mainly produced in bacterial or yeast expression systems. We describe the successful development and application of an alternative protocol for the synthesis of active hirudin based on a cell-free protein synthesis approach. Three different cell lysates were compared, and the effects of two different signal peptide sequences on the synthesis of mature hirudin were determined. The combination of K562 cell lysates and the endogenous wild-type signal peptide sequence was most effective. Cell-free synthesized hirudin showed a considerably higher anti-thrombin activity compared to recombinant hirudin produced in bacterial cells.

multidisciplinary sciences
The genome of medicinal leech (Whitmania pigra) and comparative genomic study for exploration of bioactive ingredients

Lei Tong,Shao-Xing Dai,De-Jun Kong,Peng-Peng Yang,Xin Tong,Xiang-Rong Tong,Xiao-Xu Bi,Yuan Su,Yu-Qi Zhao,Zi-Chao Liu

DOI: https://doi.org/10.1186/s12864-022-08290-5

IF: 4.547

2022-01-24

BMC Genomics

Abstract:Abstract Background Leeches are classic annelids that have a huge diversity and are closely related to people, especially medicinal leeches. Medicinal leeches have been widely utilized in medicine based on the pharmacological activities of their bioactive ingredients. Comparative genomic study of these leeches enables us to understand the difference among medicinal leeches and other leeches and facilitates the discovery of bioactive ingredients. Results In this study, we reported the genome of Whitmania pigra and compared it with Hirudo medicinalis and Helobdella robusta . The assembled genome size of W. pigra is 177 Mbp, close to the estimated genome size. Approximately about 23% of the genome was repetitive. A total of 26,743 protein-coding genes were subsequently predicted. W. pigra have 12346 (46%) and 10295 (38%) orthologous genes with H. medicinalis and H. robusta , respectively. About 20 and 24% genes in W. pigra showed syntenic arrangement with H. medicinalis and H. robusta , respectively , revealed by gene synteny analysis. Furthermore, W. pigra, H. medicinalis and H. robusta expanded different gene families enriched in different biological processes. By inspecting genome distribution and gene structure of hirudin, we identified a new hirudin gene g17108 (hirudin_2) with different cysteine patterns. Finally, we systematically explored and compared the active substances in the genomes of three leech species. The results showed that W. pigra and H. medicinalis exceed H. robusta in both kinds and gene number of active molecules. Conclusions This study reported the genome of W. pigra and compared it with other two leeches, which provides an important genome resource and new insight into the exploration and development of bioactive molecules of medicinal leeches.

genetics & heredity,biotechnology & applied microbiology
Comment on the clinical appropriateness of an emerging technology.

G. Mclean,D. Burke,D. Marinelli

DOI: https://doi.org/10.1148/172.3.941

IF: 19.7

1989-09-01

Radiology

Abstract:
A Chromosome-Level Genome Assembly of the Non-Hematophagous Leech Whitmania pigra (Whitman 1884): Identification and Expression Analysis of Antithrombotic Genes

Zichao Liu,Fang Zhao,Zuhao Huang,Bo He,Kaiqing Liu,Feng Shi,Zheng Zhao,Gonghua Lin

DOI: https://doi.org/10.3390/genes15020164

IF: 4.141

2024-01-27

Genes

Abstract:Despite being a non-hematophagous leech, Whitmania pigra is widely used in traditional Chinese medicine for the treatment of antithrombotic diseases. In this study, we provide a high quality genome of W. pigra and based on which, we performed a systematic identification of the potential antithrombotic genes and their corresponding proteins. We identified twenty antithrombotic gene families including thirteen coagulation inhibitors, three platelet aggregation inhibitors, three fibrinolysis enhancers, and one tissue penetration enhancer. Unexpectedly, a total of 79 antithrombotic genes were identified, more than a typical blood-feeding Hirudinaria manillensis, which had only 72 antithrombotic genes. In addition, combining with the RNA-seq data of W. pigra and H. manillensis, we calculated the expression levels of antithrombotic genes of the two species. Five and four gene families had significantly higher and lower expression levels in W. pigra than in H. manillensis, respectively. These results showed that the number and expression level of antithrombotic genes of a non-hematophagous leech are not always less than those of a hematophagous leech. Our study provides the most comprehensive collection of antithrombotic biomacromolecules from a non-hematophagous leech to date and will significantly enhance the investigation and utilization of leech derivatives in thrombosis therapy research and pharmaceutical applications.

genetics & heredity
18s rDNA characterization and morphological investigation of the medicinal leech Hirudo medicinalis from Felaw Pond

Samir Jawdat Bilal

DOI: https://doi.org/10.14715/cmb/2024.70.1.19

2024-02-21

Cellular and Molecular Biology

Abstract:Hirudinea leeches are obligate parasites on a variety of vertebrates and have recently gained attention for their medicinal purposes. The present study aimed to improve the presence of Hirudo medicinalis in Kurdistan and Iraq (especially because it is regarded as a native species in this region). A total of 23 leech specimens were collected from Felaw Pond during January-July 2023. The collected specimens were investigated morphologically and their species were confirmed according to their partial sequence of 18s rDNA. Primers used were universal, C1 (ACCCGCTGAATTTAAGCAT) (forward primer), and C3 (CTCTTCAGAGTACTTTTCAAC) (reverse primer). The results of the morphological study and molecular sequencing of partial 18s rDNA demonstrated that all these leech specimens belonged to Hirudo medicinalis with an abundance of 0.13 leech/ m 2 . The present record was the first one investigating this species in Iraq.

cell biology,biochemistry & molecular biology
Comparative genomics of three non-hematophagous leeches (Whitmania spp.): focusing on antithrombotic genes

Fang Zhao,Zuhao Huang,Lizhou Tang,Bo He,Zichao Liu,Gonghua Lin

DOI: https://doi.org/10.1101/2024.05.08.590400

2024-05-10

Abstract:Leeches are well known for their blood-feeding habits and are widely used for medicinal purposes as they secrete various antithrombotic substances. However, some leeches such as Whitmania spp. exhibit non-hematophagous feeding habits and their significance for medicinal use is debated. In this study, we provide chromosome-level genomes of two non-hematophagous leeches Whitmania acranulata and Whitmania laevis, and combined with our previous results of Whitmania pigra, we systematically analyzed the similarities and differences on the genomes and especially their antithrombotic genes among the three non-hematophagous Whitmania leeches. For W. acranulata, W. laevis, and W. pigra, the genome size (181.72 Mb, 173.87 Mb, and 173.56), the percentage of repeat sites (29.55%, 28.28%, and 27.02%), and the number of protein-coding genes (27,068, 23,805, and 24,156) were close to each other, respectively. In contrast, both the total number of the antithrombotic genes (100, 63, and 79), and the detailed constitutes of different antithrombotic gene families were obviously different among the three leeches. There were also massive genetic variations among the members within each antithrombotic gene/protein family. RNA-Seq-based gene expression estimation showed that the expression profiles of the antithrombotic gene families were apparently different among the three leeches. This is the most comprehensive comparison of the genomes and antithrombic biomacromolecules for the Whitmania leeches to date. Our results will greatly facilitate the evolutionary research and application of leech derivatives for medical and pharmaceutical purposes of thrombosis.

Genomics
Analysis of codon usage patterns in Hirudinaria manillensis reveals a preference for GC-ending codons caused by dominant selection constraints

De-Long Guan,Li-Bin Ma,Muhammad Salabat Khan,Xiu-Xiu Zhang,Sheng-Quan Xu,Juan-Ying Xie

DOI: https://doi.org/10.1186/s12864-018-4937-x

IF: 4.547

2018-07-17

BMC Genomics

Abstract:BackgroundHirudinaria manillensis is an ephemeral, blood-sucking ectoparasite, possessing anticoagulant capacities with potential medical applications. Analysis of codon usage patterns would contribute to our understanding of the evolutionary mechanisms and genetic architecture of H. manillensis, which in turn would provide insight into the characteristics of other leeches. We analysed codon usage and related indices using 18,000 coding sequences (CDSs) retrieved from H. manillensis RNA-Seq data.ResultsWe identified four highly preferred codons in H. manillensis that have G/C-endings. Points generated in an effective number of codons (ENC) plot distributed below the standard curve and the slope of a neutrality plot was less than 1. Highly expressed CDSs had lower ENC content and higher GC content than weakly expressed CDSs. Principal component analysis conducted on relative synonymous codon usage (RSCU) values divided CDSs according to GC content and divided codons according to ending bases. Moreover, by determining codon usage, we found that the majority of blood-diet related genes have undergone less adaptive evolution in H. manillensis, except for those with homologous sequences in the host species.ConclusionsCodon usage in H. manillensis had an overall preference toward C-endings and indicated that codon usage patterns are mediated by differential expression, GC content, and biological function. Although mutation pressure effects were also notable, the majority of genetic evolution in H. manillensis was driven by natural selection.

genetics & heredity,biotechnology & applied microbiology
Progress and Prospect of Hirudin and Its Derivants Research

YU Min,HUANG Yi-nong,MO Wei

2011-01-01

Abstract:Natural hirudin is derived from saliva of medical leeches.It is a single-chain,carbohydrate-free polypeptide containing 65—66 amino acid with a molecular weight of 7000Da.It is a powerful and specific thrombin inhibitor,and has an important significance in clinical treatment of thrombosis diseases.Recently,several derivants of hirudin have been successfully developed,Comparing with traditional anticoagulants,they have a better therapeutic effect.We summarize the research progress of recombinant hirudin.The prospect of application is also discussed.

Heterosexual transmission of human immunodeficiency virus type 1 subtype C in southern Brazil.

The effect of continuous enteral nutrition on gastric acidity in humans.

Diversity of hirudin and hirudin-like factor genes in the North-African medicinal leech, Hirudo troctina

Hirudin and Decorsins of the North American Medicinal Leech Macrobdella decora: Gene Structure Reveals Homology to Hirudins and Hirudin-like Factors of Eurasian Medicinal Leeches

The hirudin-like factors HLF3 and HLF4-hidden hirudins of European medicinal leeches

NutraStick: portable diet assistant

Short tail stories: the hirudin-like factors HLF6 and HLF7 of the Asian medicinal leech, Hirudinaria manillensis

Characterization of a persistent respiratory syncytial virus showing a low-fusogenic activity associated to an impaired F protein.

Life without blood: Molecular and functional analysis of hirudins and hirudin-like factors of the Asian non-hematophagous leech Whitmania pigra

Make it double: identification and characterization of a Tandem-Hirudin from the Asian medicinal leech Hirudinaria manillensis

[Pulmonary hypertension from the viewpoint of the pediatric pulmonologist].

Salivary gland transcriptome analysis in Hirudinaria sp. during different feeding periods and functional studies of HspHirudin

Exploring a Hirudin variant from nonhematophagous leeches: Unraveling full-length sequence, alternative splicing, function, and potential as a novel anticoagulant polypeptide

Cell-free synthesis of the hirudin variant 1 of the blood-sucking leech Hirudo medicinalis

The genome of medicinal leech (Whitmania pigra) and comparative genomic study for exploration of bioactive ingredients

Comment on the clinical appropriateness of an emerging technology.

A Chromosome-Level Genome Assembly of the Non-Hematophagous Leech Whitmania pigra (Whitman 1884): Identification and Expression Analysis of Antithrombotic Genes

18s rDNA characterization and morphological investigation of the medicinal leech Hirudo medicinalis from Felaw Pond

Comparative genomics of three non-hematophagous leeches (Whitmania spp.): focusing on antithrombotic genes

Analysis of codon usage patterns in Hirudinaria manillensis reveals a preference for GC-ending codons caused by dominant selection constraints

Progress and Prospect of Hirudin and Its Derivants Research