Abstract:Following the publication of the above article, an interested reader drew to our attention the fact that the forward primer reported in Table I on p. 3 for miR‑545‑3p (5'‑TGGCTCAGTTCAGCAGGAAC‑3') was actually for miR‑24‑3p (5'‑UGGCUCAGUUCAGCAGGAACAG‑3'). Upon performing an independent analysis of the primer sequences in the Editorial Office, the sequence presented for miR‑670‑5p also appeared to have potentially been written incorrectly. After having drawn these matters to the attention of the authors, they realized that these sequences had indeed been written incorrectly in Table I. The corrected version of Table I, featuring the correct forward and reverse primer sequences for both miR‑670‑5p and miR‑545‑3p, is shown opposite. The authors wish to thank the interested reader for drawing this error to their attention, and are grateful to the Editor of Molecular Medicine Reports for allowing them this opportunity to publish a Corrigendum. They also apologize to the readership for any inconvenience caused. [Molecular Medicine Reports 25: 202, 2022; DOI: 10.3892/mmr.2022.12718].

Co-delivery of 5-fluorouracil and miRNA-34a mimics by host-guest self-assembly nanocarriers for efficacious targeted therapy in colorectal cancer patient-derived tumor xenografts: Erratum

Corrigendum: Effective Delivery of siRNA-Loaded Nanoparticles for Overcoming Oxaliplatin Resistance in Colorectal Cancer

Corrigendum: Dual-Targeting Nanoparticle-Mediated Gene Therapy Strategy for Hepatocellular Carcinoma by Delivering Small Interfering RNA

Codelivery of Doxorubicin and MDR1-siRNA by Mesoporous Silica Nanoparticles-Polymerpolyethylenimine to Improve Oral Squamous Carcinoma Treatment [Corrigendum]

Erratum to “Near-infrared responsive 5-fluorouracil and indocyanine green loaded MPEG-PCL nanoparticle integrated with dissolvable microneedle for skin cancer therapy” [Bioact. Mater. 5 (2020) 542–552]

Blood TfR+ exosomes separated by a pH-responsive method deliver chemotherapeutics for tumor therapy: Erratum

Correction To: MiRNA-195-5p Functions As a Tumor Suppressor and a Predictive of Poor Prognosis in Non-small Cell Lung Cancer by Directly Targeting CIAPIN1

Corrigendum to “Transferrin-Guided Intelligent Nanovesicles Augment the Targetability and Potency of Clinical PLK1 Inhibitor to Acute Myeloid Leukemia” [bioact. Mater. 21 (march 2023) 499–510]

Erratum: Author correction to 'Co-delivery of nigericin and decitabine using hexahistidine-metal nanocarriers for pyroptosis-induced immunotherapeutics' [Acta Pharm Sin B 12 (2022) 4458-4471]

Erratum: Author correction to 'VEGFR2-targeted antibody fused with IFNamut regulates the tumor microenvironment of colorectal cancer and exhibits potent anti-tumor and anti-metastasis activity' [Acta Pharm Sin B 11 (2021) 420-433]

Correction To: Targeted Therapy for Cisplatin‐resistant Lung Cancer Via Aptamer‐guided Nano‐zinc Carriers Containing USP14 Sirna

Correction to: Exosomes derived from gemcitabine resistant cells transfer malignant phenotypic traits via delivery of miRNA-222-3p

Corrigendum: An in vivo fluorescence resonance energy transfer-based imaging platform for targeted drug discovery and cancer therapy

Corrigendum to “Suppression of IL-6 Gene by shRNA Augments Gemcitabine Chemosensitization in Pancreatic Adenocarcinoma Cells”

Corrigendum: Targeting HER3 to overcome RGFR TKI resistance in NSCLC

Erratum: Dual inhibition of PFKFB3 and VEGF normalizes tumor vasculature, reduces lactate production, and improves chemotherapy in glioblastoma: insights from protein expression profiling and MRI: Erratum

Corrigendum: MicroRNA-608 Promotes Apoptosis in Non-Small Cell Lung Cancer Cells Treated With Doxorubicin Through the Inhibition of TFAP4

Corrigendum to “A tumor cell membrane-coated self-amplified nanosystem as a nanovaccine to boost the therapeutic effect of anti-PD-L1 antibody” [Bioact. Mater. 21 299–312]

[Corrigendum] Knockdown of circ_0067934 inhibits gastric cancer cell proliferation, migration and invasion via the miR‑1301‑3p/KIF23 axis

Author Correction: Aptamer-mediated survivin RNAi enables 5-fluorouracil to eliminate colorectal cancer stem cells

Correction: Co-delivery of anionic epitope/CpG vaccine and IDO inhibitor by self-assembled cationic liposomes for combination melanoma immunotherapy