Effect of Tbx1 Knock-Down on the Expression of Tbx20 and Tbx2 in Zebrafish
张立凤,桂永浩,王跃祥,蒋璆,宋后燕
DOI: https://doi.org/10.3969/j.issn.1005-4847.2009.05.001
2009-01-01
Abstract:Objective Tbx1,one of the genes mapped within the del22q11 locus in human,is important for aortic arch formation and also contributes to the development of the outflow tract.Tbx1 currently represents the most promising candidate gene for DiGeorge syndrome.The hierarchical interaction between different T-box genes was revealed to play a central role of early heart patterning and morphogenesis.The aim of this study was to explore the effect of Tbx1 knock-down on the expressions of two other T-box genes,Tbx2 and Tbx20 in zebrafish.Methods Wild-type(AB* strain) zebrafish stocks were obtained from the International Zebrafish Research Center(IZRC).The following morpholino oligos(Gene Tools LLC,Corvallis,OR,USA) were designed against the translational start codon,and the sequence was 5′CAGGTCGCGTTTAACATTTAGGTTA 3′.The positive control and standard control morpholino were designed for control microinjections.The morpholino oligos at the indicated concentrations were microinjected into single-to-four-cell stage zebrafish embryos.The RNA antisense probes of Tbx20,Bmp2b and Tbx2 used for in situ hybridization were prepared.Whole-mount in situ hybridization was used to monitor the expressions of Tbx20,Bmp2b and Tbx2.Stained embryos were examined under Olympus BX61 and SZX12 microscopes,and photographed with a DP70 digital camera.The experiments involving control and experimental embryos were conducted in parallel.Results Tbx1 morpholino was injected into fertilized eggs in various doses to determine an optimal dose.Embryos presented a consistent phenotype with doses between 5-10 ng MO/embryo(57%,n=100).While injection of the same amount of control-MO could not produce the specific effect,demonstrating that these results were not due to an injection artifact.Tbx1 morphant embryos were characterized by defects in the pharyngeal arches,otic vesicle,aortic arches and thymus.During zebrafish embryogenesis,the expression of Tbx20 was found in the anterior lateral plate mesoderm,heart field,branchiomotor neuron,retina and endothelium of the dorsal aorta.In Tbx1 morphant embryos,the expression of Tbx20 in the heart was strongly reduced at 25-somite stage when compared with control-MO embryos.From 24 hpf onwards,Tbx20 was strongly expressed throughout the linear heart tube,including outflow tract,ventricle,atrium and sinus venous.At 48 hpf,the alterations of Tbx20 expression became more apparent in Tbx1 morphant embryos,serious down-regulation in the branchiomotor neurons.Bmp2b was expressed in the pharyngeal pouches(1-5) and heart robustly at 48 hpf.The expression profile of Bmp2b was altered in Tbx1 morphant embryos.Bmp2b expression was severely down-regulated in Tbx1 morphant embryos at this stage.The expression of Bmp2b in posterior pharyngeal pouches was the most affected,and nearly absent,whereas the expression in the anterior pharyngeal pouches were slightly reduced.But the expression of Bmp2b was only slightly decreased in the heart region at 48 hpf when compared with the control-MO.From 20-somite to long-pec stage,Tbx2 continued to express in the pharyngeal arches and otic vesicle in zebrafish.Tbx2 was expressed overlapping with Tbx1 in the pharyngeal arches 3-7 and otic vesicle in zebrafish.Tbx2 expressed in the ventral anterior diencephalons,posterior retina,otic vesicle,neural tube,retina and pharyngeal arches 3-7 at 20-somite stage.The expression of Tbx2 was significantly reduced or absent in pharyngeal arches 3-7 at 20-somite in Tbx1 morphant embryo.The difference became more apparent at prim-5 stage when compared to the control-MO embryos.The expression of Tbx2 was down-regulated in posterior arches at 48 hpf in Tbx1 morphant embryos when compared with the controlMO embryos.In addition,Tbx2 expression domain was shrunk when compared with the control-MO embryos at the same stage.The altered expression of Tbx2 in the pharyngeal arches lasted till 72 hpf.The difference of Tbx2 expression was indistinguishable between Tbx1 morphant and control-MO embryos in the other regions.Conclusion Tbx1 morphant embryos show defects in the pharyngeal arches,otic vesicle,aortic arches and thymus.Tbx1 specific antisense morpholino injections can successfully phenocopy the known loss-of-function phenotype of van gogh mutant.T-box genes may not function by themselves in the regulation of heart development,but may need to interact with other T-box transcriptional factors.Tbx1 may affect Bmp2b and secondarily affect the expression of Tbx20.Our results raise the possibility that there is a relationship between Tbx1 and Tbx2 during pharyngeal arch development directly or indirectly,and suggest that Tbx1 may interact with other important T-box containing transcription factor,including Tbx20 and Tbx2.