Abstract:Autosomal Dominant Polycystic Kidney Disease is characterized by renal cyst development, often leading to kidney enlargement and failure. We conducted whole exome sequencing on 14 participants (12 families) from an Indian cohort. Our analysis revealed a spectrum of genetic variants, predominantly in the These in included missense variants such as p.Glu2937Lys (c.8809G>A) and p.Gly2310Arg (c.6928G>A), p.Asp2095Gly (c.6284A>G), p.Thr938Met (c.2813C>T), p.Trp967Arg (c.2899T>C), p.Glu593* (c.1777G>T), frameshift variants p.Gln149fs*141 (c.445delC), p.Ser3305fs*84 (c.9914_9915delCT), p.His1347fs*83 (c.4041_4042delCA), and p.Leu2776fs*87(c.8327_8363delTGGCGGGCGAGGAGATCGTGGCCCAGGGCAAGCGCTC), intronic splice site variant c.8017-3C>G, nonsense variant p.Glu593* (c.1777G>T) and in missense variant p.Ser370Asn (c.1109G>A). While one individual carried intronic (c.2358+5G>A) and 3’UTR (c.*174G>T) variants in only another individual carried variants in both and , suggesting potential genetic complexity. Clinical data revealed diverse presentations. Age at diagnosis varied widely. Patients with frameshift variants exhibited earlier onset and severe manifestations, including bilateral ADPKD. One proband had right unilateral ADPKD. Involvement of liver, a common extra-renal manifestation, was also observed. Heterogeneity at phenotypic and at allelic level was observed in our cohort. In this study, using WES of a trio, a frameshift-truncation deletion [c.32del/p.Leu11ArgfsTer61] in was found to be associated with the disease shared by both the affected and early diagnosed mother and daughter carrying missense variant, which had not been previously reported in ADPKD. Further, differential gene expression analysis using data from GEO database showed reduced MIOX expression in ADPKD cystic samples compared to minimal cystic tissues and controls. MIOX is an enzyme specific to renal tubules and catalyses the initial step of the kidney-based myoinositol catabolism. Both affected candidates also shared benign variants and other variations of uncertain significance which may influence the disease development. Further functional analysis will clarify how MIOX contributes to the disease. The study limitations include the small sample size and the need for validation in larger cohorts. Our findings highlight the importance of genetic analysis in ADPKD management especially to facilitate personalized therapeutic strategies.

A unique subset of pericystic endothelium associates with aberrant microvascular remodelling and impaired blood perfusion early in polycystic kidney disease

Autosomal Dominant Polycystic Kidney Disease with Ectopic Unilateral Multicystic Dysplastic Kidney

Cilia to basement membrane signalling is a biomechanical driver of autosomal dominant polycystic kidney disease

Defining cellular complexity in human autosomal dominant polycystic kidney disease by multimodal single cell analysis

Clinical Findings, Underlying Pathogenetic Processes and Treatment of Vascular Dysfunction in Autosomal Dominant Polycystic Kidney Disease

Decoupling shear stress and pressure effects in the biomechanics of autosomal dominant polycystic kidney disease using a perfused kidney-on-chip.

Insights into Autosomal Dominant Polycystic Kidney Disease from Genetic Studies

Single-Cell and CellChat Resolution Identifies Collecting Duct Cell Subsets and Their Communications with Adjacent Cells in PKD Kidneys

Multiscale and multimodal evaluation of autosomal dominant polycystic kidney disease development

Cross-Species Insights into Autosomal Dominant Polycystic Kidney Disease: Provide an Alternative View on Research Advancement.

Up-Regulation of DNA Damage Response Signaling in Autosomal Dominant Polycystic Kidney Disease

Elevated TGFβ–Smad Signalling in Experimental Pkd1 Models and Human Patients with Polycystic Kidney Disease

Extracellular vesicles and exosomes generated from cystic renal epithelial cells promote cyst growth in autosomal dominant polycystic kidney disease

Vascular Dysfunction in Polycystic Kidney Disease: A Mini-Review

Global analysis of urinary extracellular vesicle small RNAs in autosomal dominant polycystic kidney disease

Provide an Alternative View on Research Advancement

Polycystic Kidney Disease: Novel Insights into Polycystin Function.

Early Markers of Cardiovascular Risk in Autosomal Dominant Polycystic Kidney Disease

Systems biology approach to identify transcriptome reprogramming and candidate microRNA targets during the progression of polycystic kidney disease

A Whole Exome Sequencing Study of a small Indian Autosomal Dominant Polycystic Kidney Disease Patient Cohort

Extrarenal Involvement