A Practise on CRISPR-Cas 9 Gene Editing

This notebook is about to design a strategy to knockout human AGR2 in human colon cancer cell lines using the GeneArt® CRISPR Nuclease Vector (Catalogue No. A21174 from Thermo Fisher Scientific).

1 What does CRISPR System Contain?

As it is shown in the following figure (Jiang F, Doudna JA. 2017.), the essential components required for gene editing with the CRISPR-Cas9 system include:

• Cas9: A nuclease enzyme capable of cleaving DNA.
• crRNA: An RNA sequence that contains the complementary sequence to the target DNA, guiding Cas9 to the precise location for cutting.
• tracrRNA: This RNA molecule associates with crRNA and facilitates the recognition and cutting action of Cas9.
• PAM Sequence: A short sequence on the target DNA crucial for the recognition and cleaving activity of Cas9.

2 Materials needed--AGR2 gene sequence

Before everything is going on, I got the whole AGR2 gene sequence in NCBI. Based on data from NCBI, I have annotated the exons and coding sequence (CDS) of human mRNA (NCBI accession number: NM_006408.4) in Benchling.

3 Target Site Selection

Benchling was used to identify the target sites within the human AGR2 gene that are suitable for CRISPR/Cas9 editing. These should be unique to the gene to avoid off-target effects.

Opting for a sequence that strikes a balance between a high on-target efficiency and a minimal off-target rate, I selected ATTGGAAGAAGAGCAAAGGG as the target. Its associated Protospacer Adjacent Motif (PAM) sequence is TGG.

4 Guide RNA Design

CRISPR RNA (crRNA) will guide the Cas9 nuclease to the specific location in the AGR2 gene. And it should be about 20 nucleotides long and immediately precede a PAM (Protospacer Adjacent Motif) sequence, which is essential for Cas9 binding and cleavage. CrRNA Sequence：5’-AUUGGAAGAAGAGCAAAGGG-3’ Oligonucleotide Synthesis Synthesize two oligonucleotides, the top and bottom strands, which will be complementary to each other and contain the crRNA sequence. These will be annealed to form the double-stranded DNA template for the crRNA. Top Stand Oligo：5’-AUUGGAAGAAGAGCAAAGGGGTTTT-3’ Bottom Strand Oligo：5’- AAAACCCCTTTGCTCTTCTTCCAAT-3’

5 Vector Construction

Clone the annealed oligonucleotides into the GeneArt® CRISPR Nuclease Vector, which contains a Cas9 expression cassette, using the cloning strategy recommended by the manufacturer. I found the sequence of GeneArt® CRISPR Nuclease Vector in this url: https://www.snapgene.com/plasmids/crispr_plasmids/GeneArt_CRISPR_Nuclease_Vector_-_OFP_(linearized) . Upon consulting the manufacturer's manual, I discovered that the plasmid's promoter is the CMV Promoter. Therefore, I need to insert the annealed oligonucleotides between the CMV Promoter and the structural gene of Cas9. In the unannotated sequence between the CMV Promoter and the Cas9 structural gene, there are three segments that can be recognized by restriction enzymes. I opted for the EagI recognition sequence 5’-CGGCCG-3’ as the restriction site for inserting the target gene sequence, rather than choosing BspEI, because a recognition sequence for BspEI exists within the Cas9 structural gene.

However, it's crucial to note that within the plasmid, another EagI restriction recognition site is situated downstream of the V5 tag and the SV40 NLS, and upstream of the Cas9 structural gene. This site should be excised as its presence may result in the loss of the V5 tag and SV40 NLS during the integration of the target gene into the plasmid. These two elements, the V5 tag and SV40 NLS, are vital. The V5 tag is a peptide derived from the P and V proteins of the Simian Virus 5 (SV5), comprising amino acid residues 95-108, and is commonly fused to the N- or C-terminus of target proteins. In CRISPR plasmids, its primary function is to assist researchers in tracking and detecting specific proteins. Moreover, the SV40 NLS (Nuclear Localization Signal) is a protein domain, typically a short sequence of amino acids, which interacts with nuclear transport receptors, enabling the protein to be transported into the cell nucleus. In CRISPR plasmids, the SV40 NLS is added to both the N- and C-terminus of the Cas9 protein, ensuring that the Cas9-gRNA complex can swiftly enter the nucleus from the cytoplasm after transfection into the cell.

Subsequently, I inserted the previously designed oligonucleotides immediately downstream of the first EagI restriction recognition site, labeling them as CRISPR RNA. Following this insertion, I added another EagI recognition sequence to facilitate future modifications or insertions. Next, I incorporated a short Kozak sequence (5’-GCCGCC-3’) at the 5' end of the CRISPR RNA. This sequence is crucial for initiating translation in eukaryotic cells, ensuring efficient synthesis of the encoded protein. The final design of the plasmid is now ready for review. https://benchling.com/s/seq-QmxkyG2wXf8nDU5zlraj?m=slm-KcL8mwQOAL0KnPAEVjcZ 。

6 Cell Transfection, Screening, and Off-target Analysis

Next, the constructed vector should be transfected into the human colon cancer cell lines. After transfection, screen for successful knockout of AGR2 using PCR, sequencing, or a functional assay to confirm the loss of gene expression. Then Assess potential off-target effects by sequencing other potential sites that the designed crRNA might target. These should be conducted in real-life experiment, which is out of scope of Bioinformatics.